A 28,000 Years Old Cro-Magnon mtDNA Sequence Differs from All Potentially Contaminating Modern Sequences

A 28,000 Years Old Cro-Magnon mtDNA Sequence
Differs from All Potentially Contaminating Modern
Sequences
David Caramelli1, Lucio Milani1, Stefania Vai1,2, Alessandra Modi1,
Elena Pecchioli3, Matteo Girardi3,
Elena Pilli1, Martina Lari1, Barbara Lippi4, Annamaria Ronchitelli5,
Francesco Mallegni4, Antonella
Casoli6, Giorgio Bertorelle2, Guido Barbujani2*
1 Dipartimento di Biologia Evoluzionistica, Universita` di Firenze,
Firenze, Italy, 2 Dipartimento di Biologia ed Evoluzione , Universita`
di Ferrara, Ferrara, Italy, 3 Centro di
Ecologia Alpina Fondazione Edmund Mach, Viote del Monte Bondone,
Trento, Italy, 4 Dipartimento di Biologia, Universita` di Pisa, Pisa,
Italy, 5 Dipartimento di
Dipartimento di Scienze Ambientali , Universita` di Siena, Siena,
Italy, 6 Dipartimento di Chimica Generale e Inorganica, Chimica
Analitica, Chimica Fisica, Universita` di
Parma, Parma, Italy
Abstract
Background: DNA sequences from ancient speciments may in fact result
from undetected contamination of the ancient
specimens by modern DNA, and the problem is particularly challenging
in studies of human fossils. Doubts on the
authenticity of the available sequences have so far hampered genetic
comparisons between anatomically archaic
(Neandertal) and early modern (Cro-Magnoid) Europeans.
Methodology/Principal Findings: We typed the mitochondrial DNA (mtDNA)
hypervariable region I in a 28,000 years old
Cro-Magnoid individual from the Paglicci cave, in Italy (Paglicci 23)
and in all the people who had contact with the sample
since its discovery in 2003. The Paglicci 23 sequence, determined
through the analysis of 152 clones, is the Cambridge
reference sequence, and cannot possibly reflect contamination because
it differs from all potentially contaminating modern
sequences.
Conclusions/Significance:: The Paglicci 23 individual carried a mtDNA
sequence that is still common in Europe, and which
radically differs from those of the almost contemporary Neandertals,
demonstrating a genealogical continuity across
28,000 years, from Cro-Magnoid to modern Europeans. Because all
potential sources of modern DNA contamination are
known, the Paglicci 23 sample will offer a unique opportunity to get
insight for the first time into the nuclear genes of early
modern Europeans.
Citation: Caramelli D, Milani L, Vai S, Modi A, Pecchioli E, et al.
(2008) A 28,000 Years Old Cro-Magnon mtDNA Sequence Differs from All
Potentially
Contaminating Modern Sequences. PLoS ONE 3(7): e2700. doi:10.1371/
journal.pone.0002700
Editor: Henry Harpending, University of Utah, United States of America
Received April 23, 2008; Accepted June 17, 2008; Published July 16,
2008
Copyright: 2008 Caramelli et al. This is an open-access article
distributed under the terms of the Creative Commons Attribution
License, which permits
unrestricted use, distribution, and reproduction in any medium,
provided the original author and source are credited.
Funding: Study supported by funds of the Italian Ministery of the
Universities (PRIN 2006). No sponsors had any role in any phase of the
study, and the authors
do not envisage any conflict of interests.
Competing Interests: The authors have declared that no competing
interests exist.
* E-mail: g.barbuj...@unife.it
Introduction
The anatomically-archaic Europeans, the Neandertal people,
are documented in the fossil record from approximately 300,000
to 30,000 years ago. Around 45,000 years ago, anatomicallymodern
humans of the Cro-Magnoid type expanded in
Europe from the Southeast. Neandertals coexisted with them for
between 1,000 to 10,000 thousand years, depending on the region
[1], but eventually their skeletons disappeared from the fossil
record. Individuals of intermediate morphology have not been
observed. With the possible exception of one 25,000 years old
child [2], all known specimens in the relevant time interval can be
classified without ambiguity either as Neandertals or Cro-
Magnoids.
The interpretation of these findings is not straightforward.
Under the so-called Out-of-Africa model, Neandertals are
considered to be extinct, and modern Europeans are regarded as
descending exclusively from Cro-Magnoids who replaced Neandertals
in the course of their expansion from Africa [3].
Conversely, recent versions of the alternative, multiregional
model, propose that Neandertals gave a limited, but nonnegligible,
contribution to the gene pool of modern Europeans
by admixing with Cro-Magnoids (e.g. [4–6]). Analyses of
morphological traits [7], ancient Neandertal DNA [8,9], and
modern DNA diversity [10–12] are generally regarded as
supporting a recent African origin of modern humans [13],
without substantial Neandertal contribution, if any at all. In
particular, mtDNA sequences from all studied Neandertals fall out
of the range of modern variation and show no particular
relationship with modern European sequences [9,14]. However,
it is clearly impossible to rule out any degree of reproductive
interaction between the two groups. As a consequence, the
possibility has been raised that admixture did occur, but the early
Europeans of modern anatomy were not too different genetically
PLoS ONE | www.plosone.org 1 July 2008 | Volume 3 | Issue 7 | e2700
from Neandertals, or else that most Neandertal haplotypes were
lost through a process of lineage sorting, i.e. by genetic drift [5].
To clarify the evolutionary relationships between the two
anatomically-distinct groups that coexisted in Upper Paleolithic
Europe, data on DNA variation in Cro-Magnoids are of course
extremely important. At present, only two Cro-Magnoid sequences,
both from Paglicci in Southern Italy, have been published. Both of
them fall within the range of modern mtDNA variation, thus
differing sharply from all known Neandertal sequences, and both
belong to fossil specimens from which Neandertal-specific primers
failed to amplify mtDNA [15]. Serre et al. [16] confirmed that Cro-
Magnoid mtDNAs could not be amplified using Neandertal-specific
primers, but argued that the Paglicci sequences, as well as all
ancient
sequence that appear modern, cannot be considered reliable because
contamination of ancient samples by modern DNA can be proved,
but absence of contamination cannot.
Undetected contamination is doubtless a serious problem in
ancient human DNA study, as shown by the presence of modern
human DNA in samples that should not naturally contain it [16–
20]. However, the fact that such contamination can and does
occur does not imply that it cannot be recognized [21].
Presumably, modern DNA tends to permeate in the pulp cavity
of the teeth through dentinal tubules, and in the bone through the
Haversian system [22], although possibly not reaching the
osteocytes [18,19]. The main causes of contamination are the
direct handling and washing of the specimens, most likely in the
phase immediately after excavation [22,23].
In this study we had the unique opportunity to characterize
genetically a Cro-Magnoid individual, Paglicci 23, whose
tafonomic history is perfectly known. As a consequence, we could
monitor all possible contaminations from the individuals who
manipulated the sample. In this way, testing for contamination
meant comparing the sequence obtained from the Paglicci 23
bones with the sequences of all modern people who touched them,
and not with generic and hard-to define modern sequences. We
showed that: (i) the mitochondrial sequence inferred from the
analysis of the Paglicci 23 mtDNA hypervariable region I (HVR I)
cannot possibly be due to contamination by anybody who
manipulated the sample ever since its discovery in 2003, and (2)
this 28,000 years old sequence is still common in Europe, and is
the Cambridge reference sequence (CRS).
Results and Discussion
The fragmentised remains (tibia, skulls, jaw and maxilla) of a
Cro-Magnon individual, named Paglicci 23, were excavated by
F.M in 2003 from the Paglicci cave, Southern Italy. Radiocarbon
tests dated the layer to 28.100 (+/2350) years ago [24]. Because of
its fragmentary nature, the sample was neither restored nor
studied from the morpho-anatomical point of view. Therefore, no
contamination could possibly be introduced at these stages by
direct handling and washing. The remains were deposited in the
storage room at controlled temperature in the Department of
Archaeology, University of Pisa. In 2005 three splinters, a piece of
tibia (Figure 1) and two pieces of skull, were moved to the ancient
DNA laboratory at the University of Florence. In the course of the
whole process, from excavation of the remains to genetic typing,
only seven persons had any contacts with the sample, namely six of
us (F.M, S.V, A.M., E.Pi., M.L., and D.C.) and Carles Lalueza-
Fox (hereafter: C.L.) who replicated the sequence at the University
Pompeu Fabra, Barcelona.
The degree of racemization of three amino acids, aspartic acid,
alanine, and leucine, provides indirect evidence as for the presence
in
an ancient sample of amplifiable DNA. In particular, DNA is
expected to be too degraded for amplification when the D/L for Asp
is greater than 0.08 [25]. As a preliminary test of macromolecule
preservation, we measured the stereoisomeric D/L ratio for these
amino acids. The observed values, all of them compatible with good
preservation of biological macromolecules in the sample, were D/L
Asp 0.0479, D/L Glu 0.0104 D/L, Ala 0.0092. The global amino
acid content was 42,589 parts per million, and endogenous DNA
was successfully ampified from Pleistocene remains when this value
was higher than 30,000 parts per million [16].
Quantitative PCR showed a relatively large amount of mtDNA
molecules in the Paglicci 23 fossil, approximately 2300.
Contamination,
usually detected when different sequences are observed in
different cloned products, is considered unlikely if the number of
PCR template molecules is .1,000 [26]. We thus proceeded in the
analysis by initially sequencing a total of 144 clones (Table S1),
respectively 64, 32 and 48 for the three regions in which the HVR
I was divided. Reproducible mtDNA sequences corresponding to
positions 16024–16383 of the published reference sequence CRS
[27] were obtained in the Florence laboratory from the tibia and
from a skull fragment of Paglicci 23. No contamination was
observed in the extractions and PCR blanks. Amplification of long
DNA fragments, unusual for ancient DNA, was not observed. The
analysis was repeated in Barcelona, using a tibia fragment; the
consensus sequence obtained from 8 clones covering the region
between nt 16245 to nt 16349 was identical to that obtained in
Florence. On the contrary, no PCR product was observed when
we attempted to amplify the DNA extracts using two pairs of
Neandertal-specific primers.
As is common in studies of ancient DNA, when comparing
sequences across clones we observed single nucleotide substitutions
occurring in one or a few clones (Table S1), on average 3.9 every
1,000 bp. In addition, a C to T change was observed in 27 out of
56 clones at nt 16274. In principle, differences of this kind across
clones may be due to three factors, namely: (1) sequence
heterogeneity due to the presence of exogenous, contaminating
DNA, (2) post-mortem DNA damage, and (3) Taq-polymerase
Figure 1. Tibia fragment of the Paglicci 23 specimen. DNA was
extracted from this fragment and from skull splinters, and all
extracts
yielded the same HVR I sequence.
doi:10.1371/journal.pone.0002700.g001
Cro-Magnon Mitochondrial DNA
PLoS ONE | www.plosone.org 2 July 2008 | Volume 3 | Issue 7 | e2700
errors or cloning artefacts. We tested separately for the possible
effects of the first two factors upon our specimen.
To track down any possible modern contaminations, the
mtDNAs of the seven authors who to any extent manipulated
the sample were genotyped. All these sequences (Table 1) differ
from the Paglicci 239s consensus mtDNA sequence. However, two
of (F.M and C.L) have a T at nt 16274. Therefore, variation across
clones at that site might have meant that either investigator left his
DNA on the sample, although C.L. had no contacts with the
material at the stage at which clones F2.1 through F2.13 and F3.1
through F3.15 were genotyped.
Post-mortem DNA damage generally occurs in the form of
double-strand breaks, or other modifications severe enough to
prevent enzymatic replication of the DNA molecule. Had this
happen, we would have been unable to amplify the DNA.
However, hydrolytic deamination and depurination may also
occur, resulting in apparent changes of the nucleotide sequence.
Although post-mortem damages of this kind are unlikely to
severely bias the results when the initial template molecules exceed
1000 [26] as is the case for Paglicci 23, to correct for such possible
post-mortem damages, a third DNA extract was treated with
Uracyl-N-Glycosidase (UNG) [17], and independently resequenced.
The 35 sequences thus obtained (clones F 4.1 through
F4.20, and F5.1 through F 5.15) contain no nucleotide
substitutions with respect to the CRS, including nt 16274 (Table
S1). As a consequence, we concluded that the sequence obtained
from the Paglicci 23 specimen is the CRS, and that heterogeneity
across clones at nt 16274 reflects DNA damage due to
deamination of the original cytosine and successive amplification
of the damaged DNA fragment(s). The rate of nucleotide
misincorporation suggests that the DNA templates were indeed
damaged (3.9 substitutions every 1,000 bp within the HVRI), but
after UNG treatment at least 82% of the clones showed the same
consensus nucleotide at each position (Table S1).
The relationship between the Paglicci 23 sequence, the available
Cro-Magnon and Neandertal sequences, and all the sequences from
the seven individuals who manipulated the Cro-Magnons specimen,
are summarized in Figure 2. The backbone of the network is based
on the 31bp region for which we had complete overlap among all
sequences, and was estimated by a statistical parsimony method [28],
as implemented in the software TCS [29]. A sub-network was also
reconstructed for a set of eight individuals relevant to this study
using
the entire fragment of 360 bp.
Previous genetic data on Cro-Magnoids [15], although generated
under the most stringent available criteria, were considered
problematic by some authors [16,30], because the mtDNA
sequences obtained correspond to sequences also observed in
modern individuals. For most ancient human samples, rigorous
application of this criterion would render the study of Cro-Magnoid
DNA practically impossible, because it is impossible to rule out any
contamination from generic unknown individuals. However, it is
possible to test for the occurrence in the extract of known potential
contaminating sequences; for the Paglicci 23 fossil we had this
opportunity, and we found that none of these modern sequences is
equal to the sequence obtained fromthe fossil extracts. Since we used
different sets of overlapping primers pairs to amplify the fragment
included between nucleotide 16024 and 16383, it seems highly
unlikely that the sequence obtained was a chimera artefact.
Therefore, at this stage it is safe to conclude that at least one Cro-
Magnoid mtDNA sequence, for which contamination can be ruled
out with a high degree of confidence, falls well within the range of
modern human variation. This does not prove, but at least indirectly
suggests, that the previously published Cro-Magnoid sequences [15],
both documented in the modern human gene pool, may be genuine
[31]. At any rate, the finding of the Cambridge Reference Sequence
in Paglicci 23 shows that one of today’s mtDNA variants has been
present in Europe for at least 28,000 years, and that modern and
archaic anatomical features appear associated with mtDNA
sequences that can be classified, respectively, as modern and
nonmodern.
Because no HVR I sequence similar to the Neandertals’ has
been described in more than 4800 Europeans studied so far [32],
models whereby Neandertals were part of the genealogy of current
Europeans are at odds with the data, at least as far as maternal
inheritance is concerned. In our opinion, the burden of the proof is
now on those who maintain that Neandertals might have
contributed to the modern gene pool.
So far, the study of ancient nuclear DNA in humans has been
severely limited by the difficulty to ascertain whether the DNA
sequences obtained are really endogenous to the specimen. This
study shows that it is possible to test for DNA authenticity, provided
the people who manipulate the sample from the moment of
excavation are carefully recorded and their DNAs typed. Therefore,
Paglicci 23 (as well as other remains studied under comparable
conditions in the future) promises to be a valuable source of
information on DNA diversity in the past, and can pave the ground
for a more exhaustive understanding of human evolutionary history.
Materials and Methods
DNA extraction
All DNA-preparation and extraction methods followed strictly
specific ancient DNA requirements [33]. DNA was extracted in
Table 1. Mitochondrial HVR1 variation in the seven
researchers that have been in physical contact with the
samples.
Researcher Task HVR1 haplotype
F.M Excavation 16069 T, 16126 C, 16278 T, 16294 T, 16366 T
S.V Laboratory analysis 16311 C
A.M Laboratory analysis 16274 A 16311 C
M.L Laboratory analysis 16261 T, 16311 C
E.Pi Laboratory analysis 16096 A, 16126 C, 16145 A, 16189 C,
16231C, 16260 T, 16261 T,
C.L. Laboratory analysis 16126 C, 16294 T, 16296 T, 16304 C
D.C. Laboratory analysis 16193 T, 16278 T
doi:10.1371/journal.pone.0002700.t001
Figure 2. Genetic relationships among the Paglicci 23 and
other relevant mtDNA sequences. The network summarizes
mtDNA HVR I variation in 13 Neandertals (Nea1 to Nea13) , three Cro-
Magnons (CrM1 to CrM3), and seven modern humans who manipulated
the Cro-Magnons specimens (six authors of this paper and Carles
Laueza-Fox, designated by their initials).
doi:10.1371/journal.pone.0002700.g002
Cro-Magnon Mitochondrial DNA
PLoS ONE | www.plosone.org 3 July 2008 | Volume 3 | Issue 7 | e2700
two laboratories, in Florence and Barcelona, in facilities
exclusively dedicated to ancient DNA work. All DNA extractions
and PCR set up were carried out in physically separated spaces
from those in which PCR cyclings and post-PCR analysis was
conducted. Full-body suits, disposable masks and gloves were worn
throughout and were changed frequently, and pipettors were
UVirradiated
in between use. All DNA extractions and PCR reactions
included negative controls, and all steps of the analysis were
replicated at least twice in each laboratory. To test for preservation
of
other macromolecules as an indirect evidence for DNA survival [26]
we estimated the degree of aminoacid racemization, in each sample,
using approximately 5 mg of tibia and skull, powdered following the
procedures described in [25]. We quantified the amount of target
DNA by Real Time (RT) PCR. PCR products were cloned, 152
clones were sequenced, and the sequences thus obtained were
aligned and compared across clones. After extraction, UNG
treatment were performed on a third skull fragment in order to
verify whether C to T changes (nt 16294 ) observed in some clones
represented postmortem damage or contamination [17].
To prevent contamination from prior handling, the outer layer
of bones was removed with a rotary tool, and the fragments were
briefly soaked in 10% bleach. Both samples were then irradiated (1
hour under UV light) and powdered. DNA was extracted by
means of a silica-based protocol [15]. At least two independent
extracts were obtained from each remain. Multiple negative
controls were included in each extraction.
UNG treatment
Uracil bases caused by the hydrolytic deamination of cytosines
were excised by treating 10 ml of DNA extracted from both
samples with 1U of Uracil-N-Glycosylase (UNG) for 30 min at
37uC. UNG reduces sequence artefacts caused by this common
form of post-mortem damage, resulting in apparent C to T/G to A
mutations and subsequent errors in the sequence results [17]. After
this treatment, the extract was subjected to the same PCR Cloning
and sequencing conditions as described above.
Quantification of DNA Molecules
Real-time PCR amplification was performed using BrilliantH
SYBRH Green QPCR Master Mix (Stratagene) in MX3000P
(Stratagene), using 0.5mM of appropriate primers (forward primer
located at H 16107 and reverse primer located at L 16261.
Thermal cycling conditions were 95uC for 10 min, 40 cycles at
95uC for 30 s, 53uC for 1 min and 72uC for 30 s, followed by
SYBRH Green dissociation curve steep. Ten-fold serial dilutions of
the purified and quantified standard were included in the
experiment to create the standard curve in order to know the
number of initial DNA molecules in the samples
Amplification of mt DNA
Two ml of DNA extracted from the bone were amplified with
this profile: 94uC for 10 min (Taq polymerase activation), followed
by 50 cycles of PCR (denaturation , 94uC for 45 sec, annealing,
53uC for 1 min and extension, 72uC for 1 min) and final step at
72uC for 10 min. The 50 ml reaction mix contained 2 U of
AmpliTaq Gold (Applied Biosystems), 200 mM of each dNTP and
1 mM of each primer. The 360 bp long HVR-I was subdivided in
three overlapping fragments using the following primer pairs:
L15995/H16132; L16107/H16261; L16247/H16402. Each extract
was amplified at least twice. Since overlapping primers were
used throughout the PCR amplifications, it is highly unlikely that
we amplified a nuclear insertion rather than the organellar
mtDNA. Reactions conditions in replay analysis were described in
[34], except for the sequences primers that we report as follows:
59ACTATCACACATCAACTGC 39; 59ATGGGGACGAGAAGGGATTT
39.
Cloning and Sequencing
PCR products were cloned using TOPO TA Cloning Kit
(Invitrogen) according to the manufacturer’s instructions. Screening
of white recombinant colonies was accomplished by PCR,
transferring the colonies into a 30 ml reaction mix (67 mM Tris
HCl [pH 8.8], 2 mM MgCl2, 1 mM of each primer, 0.125 mM of
each dNTP, 0,75 units of Taq Polymerase) containing M13
forward and reverse universal primers. After 5 min at 92u C, 30
cycles of PCR (30 sec at 90uC, 1 min at 50uC, 1 min at 72uC)
were carried out and clones with insert of the expected size were
identified by agarose gel electrophoresis. After purification of these
PCR products with Microcon PCR devices (Amicon), a volume of
1,5 ml was cycle-sequenced following the BigDye Terminator kit
(Applied Biosystems) supplier’s instructions. The sequence was
determined using an Applied BioSystems 3100 DNA sequencer.
‘‘Long’’ amplificate detection
Appropriate molecular behaviour was also tested by amplification
of longer mtDNA fragments (443 bp and 724 bp), which have
been reported as very unusual for ancient DNA. PCR conditions
were those described for mtDNA analysis above, primers used for
443 bp fragment were L15995 and H16401, while for 724 bp
fragment primers used were L16247 and H00360.
Amplification with Neandertal-specific primers
Amplifications of the Paglicci extracts with two pairs of
Neandertal-specific primers (L16,022-NH16,139 and NL16,263/
264-NH16,400, [14]) were also attempted. 50 ml of DNA were
amplified with the following profile: 94uC for 10 min and 45 cycles
of a denaturation (94uC for 45 sec), annealing (57uC for 1 min for
the first couple and 59uC for 1 min for the second couple) and
extension step (72uC for 1 min). The 50 ml reaction mix contained
2 U of AmpliTaq Gold polymerase and 16 reaction buffer
(Applied Biosystems), 200 mM of each dNTP, 1.5mM MgCl2,
1 mM of each primer.
Extractions amplifications and sequencing of modern
DNA
MtDNA genotypes of all individuals who had any contacts with
the specimen were either known in advance (M.L., D.C. and
C.L.F: [21]), or determined in the Laboratory at Viote Trento
(S.V., E.Pi., A.M., F.M.). Buccal cells were collected by oral
brushes (Sterile Omni Swab or Sterile Foam Tipped Swabs,
Whatman International Ltd., Maidstone, UK) and DNA was
extracted using QIAmp1 DNA Mini Kit (QIAGEN, Hagen,
Germany) according to manufacturer’s instructions. The hypervariable
region I (HVR1) of the mtDNA was determined by PCR
amplification using the primers L15996 (59CTCCACCATTAGCACCCAAAGC
93) and H408 (59 CTGTTAAAAGTGCATACCGCC
93) (Table S1).
Supporting Information
Table S1 Sequences of the clones obtained by amplifying the
HVR I of mtDNA from the Paglicci 23 fossil. A dot indicates
identity with respect to the Cambridge Reference Sequence, as
modified by Ruiz-Pesini et al. [26], a letter indicates a nucleotide
substitution. In the first column, labels designate clones sequenced,
respectively, in the Florence (those beginning with an F) or
Barcelona (those beginning with a B) laboratories. Bold type: clone
Cro-Magnon Mitochondrial DNA
PLoS ONE | www.plosone.org 4 July 2008 | Volume 3 | Issue 7 | e2700
sequences after UNG treatment. The sequences of the primers are
also reported.
Found at: doi:10.1371/journal.pone.0002700.s001 (0.09 MB
DOC)
Acknowledgments
We would like to thank Carles Lalueza Fox, who replicated the
sequences
in his laboratory at the University Pompeu Fabra, Barcelona, Spain,
and
Agnar Helgason for his comments and suggestions.
Author Contributions
Conceived and designed the experiments: DC GB. Performed the
experiments: LM SV AM EP MG EP ML AC. Analyzed the data: GB
GB. Wrote the paper: DC FM GB. Collected the sample: BL FM. Dated
the sample: BL AR. Participated in preliminary tests of macromolecule
preservation: AC.
References
1. Mellars P (2006a) A new radiocarbon revolution and the dispersal of
modern
humans in Eurasia. Nature 439: 931–935.
2. Zilha˜o J (2006) Neandertals and moderns mixed, and it matters.
Evol Anthropol
15: 183–195.
3. Stringer C (2002) Modern human origins: progress and prospects.
Philos
Trans R Soc Lond B Biol Sci 357: 563–579.
4. Relethford JH (2001) Absence of regional affinities of Neandertal
DNA with
living humans does not reject multiregional evolution. Am J Phys
Anthropol 115:
95–98.
5. Relethford JH (2007) Genetic evidence and the modern human origins
debate.
Heredity 100: 555–563.
6. Wolpoff MH (2005) Multiregional Evolution. In: Renfrew C, Bahn P,
eds.
Archaeology: The Key Concepts. London: Routledge. pp 176–181.
7. Manica A, Amos W, Balloux F, Hanihara T (2007) The effect of
ancient
population bottlenecks on human phenotypic variation. Nature 448: 346–
348.
8. Krings M, Capelli C, Tschentscher F, Geisert H, Meyer S, et al.
(2000) A view of
Neandertal genetic diversity. Nat Genet 26: 144–146.
9. Lalueza-Fox C, Krause J, Caramelli D, Catalano G, Milani L, et al.
(2006)
Mitochondrial DNA of an Iberian Neandertal suggests a population
affinity with
other European Neandertals. Curr Biol. 16: R629–R630.
10. Currat M, Excoffier L (2004) Modern humans did not admix with
Neanderthals
during their range expansion into Europe. PLoS Biol. 12: e421.
11. Liu H, Prugnolle F, Manica A, Balloux FA (2006) Geographically
explicit
genetic model of worldwide human-settlement history. Am J Hum Genet
79:
230–237.
12. Ramachandran S, Deshpande O, Roseman CC, Rosenberg NA, Feldman MW,
et al. (2005) Support from the relationship of genetic and geographic
distance in
human populations for a serial founder effect originating in Africa.
Proc Natl
Acad Sci USA 102: 15942–15947.
13. Mellars P (2006b) Going east: New genetic and archaeological
perspectives on
the modern human colonization of Eurasia. Science 313: 796–800.
14. Caramelli D, Lalueza-Fox C, Condemi S, Longo L, Milani L, et al.
(2006) A
highly divergent mtDNA sequence in a Neandertal individual from Italy.
Curr.
Biol. 16: R630–R632.
15. Caramelli D, Lalueza-Fox C, Vernesi C, Lari M, Casoli A, et al.
(2003) Evidence
for a genetic discontinuity between Neandertals and 24,000-year-old
anatomically
modern Europeans. Proc Natl Acad Sci USA. 100(11): 6593–7.
16. Serre D, Langaney A, Chech M, Teschler-Nicola M, Paunovic M, et
al. (2004)
No evidence of Neandertal mtDNA contribution to early modern humans.
PLoS
Biol 3: E57.
17. Hofreiter M, Jaenicke V, Serre D, van Haeseler A, Pa¨a¨bo S (2001)
DNA
sequences from multiple amplifications reveal artifacts induced by
cytosine
deamination in ancient DNA Nucleic Acids Res 29: 4793–4799.
18. Malmstro¨m H, Stora° J, Dale´n L, Holmlund G, Go¨therstro¨m A
(2005) Extensive
human DNA contamination in extracts from ancient dog bones and teeth.
Mol
Biol Evol 10: 2040–2047.
19. Salamon M, Tuross N, Arensburg B, Weiner S (2005) Relatively well
preserved
DNA is present in the crystal aggregates of fossil bones. Proc Natl
Acad Sci USA
39: 13783–13788.
20. Lalueza-Fox C, Sampietro ML, Caramelli D, Puder Y, Lari M, et al.
(2005)
Neandertal evolutionary genetics: mitochondrial DNA data from the
Iberia
peninsula. Mol Biol Evol 22: 1077–81.
21. Sampietro ML, Gilbert MT, Lao O, Caramelli D, Lari M, et al.
(2006) Tracking
down human contamination in ancient human teeth. Mol Biol Evol 23:
1801–1807.
22. Gilbert MTP, Rudbeck L, Willerslev E, Hansen HJ, Smith C, et al.
(2005)
Biochemical and physical correlates of DNA contamination in
archaeological
human bones and teeth excavated at Matera, Italy. J Archaeol Sci 32:
783–95.
23. Gilbert MTP, Hansen AJ, Willerslev E, Turner-Walker G, Collins M
(2006)
Insights into the processes behind the contamination of degraded human
teeth
and bone samples with exogenous sources of DNA. Int J Osteoarcheol
16(2):
156–64.
24. Mallegni F (2005) Catalogue of Italian fossil human remains from
the
Palaeolithic to the Mesolithic. J Anthropol Sci 84 (Suppl.): 110.
25. Poinar HN, Hoss M, Bada JL, Pa¨a¨bo S (1996) Amino acid
racemization and the
preservation of ancient DNA. Science 272: 864–866.
26. Handt O, Krings M, Ward RM, Pa¨a¨bo S (1996) The retrieval of
ancient human
DNA sequences. Am J Hum Genet 59: 368–376.
27. Ruiz-Pesini E, Lott MT, Procaccio V, Poole J, Brandon MC, et al.
(2007) An
enhanced MITOMAP with a global mtDNA mutational phylogeny. Nucleic
Acids Res 35: D823–D828.
28. Templeton AR, Crandall KA, Sing CF (1992) A cladistic analysis of
phenotypic
associations with haplotypes inferred from restriction endonuclease
mapping and
DNA sequence data. III. Cladogram estimation. Genetics 132: 619–633.
29. Clement M, Posada D, Crandall KA (2000) TCS: a computer program to
estimate gene genealogies. Mol Ecol 9: 1657–19.
30. Abbott A (2003) Anthropologists cast doubt on human DNA evidence.
Nature
423: 468–468.
31. Barbujani G, Bertorelle G (2003) Were Cro-Magnons too like us for
DNA to
tell? Nature 424: 127.
32. http://web.unife.it/progetti/genetica/pdata.htm/PopList.xls.
33. Cooper A, Poinar H (2000) Ancient DNA: do it right or not at all.
Science 289:
1139.
34. Sampietro ML, Lao O, Caramelli D, Lari M, Pou R, et al. (2007)
Palaeogenetic
evidence supports a dual model of Neolithic spreading into Europe.
Proc Biol Sci
274: 2161–2167.
Cro-Magnon Mitochondrial DNA
PLoS ONE | www.plosone.org 5 July 2008 | Volume 3 | Issue 7 | e2700 SOURCE

A 28,000 Years Old Cro-Magnon mtDNA Sequence Differs from All Potentially Contaminating Modern Sequences