Tuesday, July 29, 2008

A 28,000 Years Old Cro-Magnon mtDNA Sequence Differs from All Potentially Contaminating Modern Sequences

A 28,000 Years Old Cro-Magnon mtDNA Sequence
Differs from All Potentially Contaminating Modern
Sequences
David Caramelli1, Lucio Milani1, Stefania Vai1,2, Alessandra Modi1,
Elena Pecchioli3, Matteo Girardi3,
Elena Pilli1, Martina Lari1, Barbara Lippi4, Annamaria Ronchitelli5,
Francesco Mallegni4, Antonella
Casoli6, Giorgio Bertorelle2, Guido Barbujani2*
1 Dipartimento di Biologia Evoluzionistica, Universita` di Firenze,
Firenze, Italy, 2 Dipartimento di Biologia ed Evoluzione , Universita`
di Ferrara, Ferrara, Italy, 3 Centro di
Ecologia Alpina Fondazione Edmund Mach, Viote del Monte Bondone,
Trento, Italy, 4 Dipartimento di Biologia, Universita` di Pisa, Pisa,
Italy, 5 Dipartimento di
Dipartimento di Scienze Ambientali , Universita` di Siena, Siena,
Italy, 6 Dipartimento di Chimica Generale e Inorganica, Chimica
Analitica, Chimica Fisica, Universita` di
Parma, Parma, Italy
Abstract
Background: DNA sequences from ancient speciments may in fact result
from undetected contamination of the ancient
specimens by modern DNA, and the problem is particularly challenging
in studies of human fossils. Doubts on the
authenticity of the available sequences have so far hampered genetic
comparisons between anatomically archaic
(Neandertal) and early modern (Cro-Magnoid) Europeans.
Methodology/Principal Findings: We typed the mitochondrial DNA (mtDNA)
hypervariable region I in a 28,000 years old
Cro-Magnoid individual from the Paglicci cave, in Italy (Paglicci 23)
and in all the people who had contact with the sample
since its discovery in 2003. The Paglicci 23 sequence, determined
through the analysis of 152 clones, is the Cambridge
reference sequence, and cannot possibly reflect contamination because
it differs from all potentially contaminating modern
sequences.
Conclusions/Significance:: The Paglicci 23 individual carried a mtDNA
sequence that is still common in Europe, and which
radically differs from those of the almost contemporary Neandertals,
demonstrating a genealogical continuity across
28,000 years, from Cro-Magnoid to modern Europeans. Because all
potential sources of modern DNA contamination are
known, the Paglicci 23 sample will offer a unique opportunity to get
insight for the first time into the nuclear genes of early
modern Europeans.
Citation: Caramelli D, Milani L, Vai S, Modi A, Pecchioli E, et al.
(2008) A 28,000 Years Old Cro-Magnon mtDNA Sequence Differs from All
Potentially
Contaminating Modern Sequences. PLoS ONE 3(7): e2700. doi:10.1371/
journal.pone.0002700
Editor: Henry Harpending, University of Utah, United States of America
Received April 23, 2008; Accepted June 17, 2008; Published July 16,
2008
Copyright: 2008 Caramelli et al. This is an open-access article
distributed under the terms of the Creative Commons Attribution
License, which permits
unrestricted use, distribution, and reproduction in any medium,
provided the original author and source are credited.
Funding: Study supported by funds of the Italian Ministery of the
Universities (PRIN 2006). No sponsors had any role in any phase of the
study, and the authors
do not envisage any conflict of interests.
Competing Interests: The authors have declared that no competing
interests exist.
* E-mail: g.barbuj...@unife.it
Introduction
The anatomically-archaic Europeans, the Neandertal people,
are documented in the fossil record from approximately 300,000
to 30,000 years ago. Around 45,000 years ago, anatomicallymodern
humans of the Cro-Magnoid type expanded in
Europe from the Southeast. Neandertals coexisted with them for
between 1,000 to 10,000 thousand years, depending on the region
[1], but eventually their skeletons disappeared from the fossil
record. Individuals of intermediate morphology have not been
observed. With the possible exception of one 25,000 years old
child [2], all known specimens in the relevant time interval can be
classified without ambiguity either as Neandertals or Cro-
Magnoids.
The interpretation of these findings is not straightforward.
Under the so-called Out-of-Africa model, Neandertals are
considered to be extinct, and modern Europeans are regarded as
descending exclusively from Cro-Magnoids who replaced Neandertals
in the course of their expansion from Africa [3].
Conversely, recent versions of the alternative, multiregional
model, propose that Neandertals gave a limited, but nonnegligible,
contribution to the gene pool of modern Europeans
by admixing with Cro-Magnoids (e.g. [4–6]). Analyses of
morphological traits [7], ancient Neandertal DNA [8,9], and
modern DNA diversity [10–12] are generally regarded as
supporting a recent African origin of modern humans [13],
without substantial Neandertal contribution, if any at all. In
particular, mtDNA sequences from all studied Neandertals fall out
of the range of modern variation and show no particular
relationship with modern European sequences [9,14]. However,
it is clearly impossible to rule out any degree of reproductive
interaction between the two groups. As a consequence, the
possibility has been raised that admixture did occur, but the early
Europeans of modern anatomy were not too different genetically
PLoS ONE | www.plosone.org 1 July 2008 | Volume 3 | Issue 7 | e2700
from Neandertals, or else that most Neandertal haplotypes were
lost through a process of lineage sorting, i.e. by genetic drift [5].
To clarify the evolutionary relationships between the two
anatomically-distinct groups that coexisted in Upper Paleolithic
Europe, data on DNA variation in Cro-Magnoids are of course
extremely important. At present, only two Cro-Magnoid sequences,
both from Paglicci in Southern Italy, have been published. Both of
them fall within the range of modern mtDNA variation, thus
differing sharply from all known Neandertal sequences, and both
belong to fossil specimens from which Neandertal-specific primers
failed to amplify mtDNA [15]. Serre et al. [16] confirmed that Cro-
Magnoid mtDNAs could not be amplified using Neandertal-specific
primers, but argued that the Paglicci sequences, as well as all
ancient
sequence that appear modern, cannot be considered reliable because
contamination of ancient samples by modern DNA can be proved,
but absence of contamination cannot.
Undetected contamination is doubtless a serious problem in
ancient human DNA study, as shown by the presence of modern
human DNA in samples that should not naturally contain it [16–
20]. However, the fact that such contamination can and does
occur does not imply that it cannot be recognized [21].
Presumably, modern DNA tends to permeate in the pulp cavity
of the teeth through dentinal tubules, and in the bone through the
Haversian system [22], although possibly not reaching the
osteocytes [18,19]. The main causes of contamination are the
direct handling and washing of the specimens, most likely in the
phase immediately after excavation [22,23].
In this study we had the unique opportunity to characterize
genetically a Cro-Magnoid individual, Paglicci 23, whose
tafonomic history is perfectly known. As a consequence, we could
monitor all possible contaminations from the individuals who
manipulated the sample. In this way, testing for contamination
meant comparing the sequence obtained from the Paglicci 23
bones with the sequences of all modern people who touched them,
and not with generic and hard-to define modern sequences. We
showed that: (i) the mitochondrial sequence inferred from the
analysis of the Paglicci 23 mtDNA hypervariable region I (HVR I)
cannot possibly be due to contamination by anybody who
manipulated the sample ever since its discovery in 2003, and (2)
this 28,000 years old sequence is still common in Europe, and is
the Cambridge reference sequence (CRS).
Results and Discussion
The fragmentised remains (tibia, skulls, jaw and maxilla) of a
Cro-Magnon individual, named Paglicci 23, were excavated by
F.M in 2003 from the Paglicci cave, Southern Italy. Radiocarbon
tests dated the layer to 28.100 (+/2350) years ago [24]. Because of
its fragmentary nature, the sample was neither restored nor
studied from the morpho-anatomical point of view. Therefore, no
contamination could possibly be introduced at these stages by
direct handling and washing. The remains were deposited in the
storage room at controlled temperature in the Department of
Archaeology, University of Pisa. In 2005 three splinters, a piece of
tibia (Figure 1) and two pieces of skull, were moved to the ancient
DNA laboratory at the University of Florence. In the course of the
whole process, from excavation of the remains to genetic typing,
only seven persons had any contacts with the sample, namely six of
us (F.M, S.V, A.M., E.Pi., M.L., and D.C.) and Carles Lalueza-
Fox (hereafter: C.L.) who replicated the sequence at the University
Pompeu Fabra, Barcelona.
The degree of racemization of three amino acids, aspartic acid,
alanine, and leucine, provides indirect evidence as for the presence
in
an ancient sample of amplifiable DNA. In particular, DNA is
expected to be too degraded for amplification when the D/L for Asp
is greater than 0.08 [25]. As a preliminary test of macromolecule
preservation, we measured the stereoisomeric D/L ratio for these
amino acids. The observed values, all of them compatible with good
preservation of biological macromolecules in the sample, were D/L
Asp 0.0479, D/L Glu 0.0104 D/L, Ala 0.0092. The global amino
acid content was 42,589 parts per million, and endogenous DNA
was successfully ampified from Pleistocene remains when this value
was higher than 30,000 parts per million [16].
Quantitative PCR showed a relatively large amount of mtDNA
molecules in the Paglicci 23 fossil, approximately 2300.
Contamination,
usually detected when different sequences are observed in
different cloned products, is considered unlikely if the number of
PCR template molecules is .1,000 [26]. We thus proceeded in the
analysis by initially sequencing a total of 144 clones (Table S1),
respectively 64, 32 and 48 for the three regions in which the HVR
I was divided. Reproducible mtDNA sequences corresponding to
positions 16024–16383 of the published reference sequence CRS
[27] were obtained in the Florence laboratory from the tibia and
from a skull fragment of Paglicci 23. No contamination was
observed in the extractions and PCR blanks. Amplification of long
DNA fragments, unusual for ancient DNA, was not observed. The
analysis was repeated in Barcelona, using a tibia fragment; the
consensus sequence obtained from 8 clones covering the region
between nt 16245 to nt 16349 was identical to that obtained in
Florence. On the contrary, no PCR product was observed when
we attempted to amplify the DNA extracts using two pairs of
Neandertal-specific primers.
As is common in studies of ancient DNA, when comparing
sequences across clones we observed single nucleotide substitutions
occurring in one or a few clones (Table S1), on average 3.9 every
1,000 bp. In addition, a C to T change was observed in 27 out of
56 clones at nt 16274. In principle, differences of this kind across
clones may be due to three factors, namely: (1) sequence
heterogeneity due to the presence of exogenous, contaminating
DNA, (2) post-mortem DNA damage, and (3) Taq-polymerase
Figure 1. Tibia fragment of the Paglicci 23 specimen. DNA was
extracted from this fragment and from skull splinters, and all
extracts
yielded the same HVR I sequence.
doi:10.1371/journal.pone.0002700.g001
Cro-Magnon Mitochondrial DNA
PLoS ONE | www.plosone.org 2 July 2008 | Volume 3 | Issue 7 | e2700
errors or cloning artefacts. We tested separately for the possible
effects of the first two factors upon our specimen.
To track down any possible modern contaminations, the
mtDNAs of the seven authors who to any extent manipulated
the sample were genotyped. All these sequences (Table 1) differ
from the Paglicci 239s consensus mtDNA sequence. However, two
of (F.M and C.L) have a T at nt 16274. Therefore, variation across
clones at that site might have meant that either investigator left his
DNA on the sample, although C.L. had no contacts with the
material at the stage at which clones F2.1 through F2.13 and F3.1
through F3.15 were genotyped.
Post-mortem DNA damage generally occurs in the form of
double-strand breaks, or other modifications severe enough to
prevent enzymatic replication of the DNA molecule. Had this
happen, we would have been unable to amplify the DNA.
However, hydrolytic deamination and depurination may also
occur, resulting in apparent changes of the nucleotide sequence.
Although post-mortem damages of this kind are unlikely to
severely bias the results when the initial template molecules exceed
1000 [26] as is the case for Paglicci 23, to correct for such possible
post-mortem damages, a third DNA extract was treated with
Uracyl-N-Glycosidase (UNG) [17], and independently resequenced.
The 35 sequences thus obtained (clones F 4.1 through
F4.20, and F5.1 through F 5.15) contain no nucleotide
substitutions with respect to the CRS, including nt 16274 (Table
S1). As a consequence, we concluded that the sequence obtained
from the Paglicci 23 specimen is the CRS, and that heterogeneity
across clones at nt 16274 reflects DNA damage due to
deamination of the original cytosine and successive amplification
of the damaged DNA fragment(s). The rate of nucleotide
misincorporation suggests that the DNA templates were indeed
damaged (3.9 substitutions every 1,000 bp within the HVRI), but
after UNG treatment at least 82% of the clones showed the same
consensus nucleotide at each position (Table S1).
The relationship between the Paglicci 23 sequence, the available
Cro-Magnon and Neandertal sequences, and all the sequences from
the seven individuals who manipulated the Cro-Magnons specimen,
are summarized in Figure 2. The backbone of the network is based
on the 31bp region for which we had complete overlap among all
sequences, and was estimated by a statistical parsimony method [28],
as implemented in the software TCS [29]. A sub-network was also
reconstructed for a set of eight individuals relevant to this study
using
the entire fragment of 360 bp.
Previous genetic data on Cro-Magnoids [15], although generated
under the most stringent available criteria, were considered
problematic by some authors [16,30], because the mtDNA
sequences obtained correspond to sequences also observed in
modern individuals. For most ancient human samples, rigorous
application of this criterion would render the study of Cro-Magnoid
DNA practically impossible, because it is impossible to rule out any
contamination from generic unknown individuals. However, it is
possible to test for the occurrence in the extract of known potential
contaminating sequences; for the Paglicci 23 fossil we had this
opportunity, and we found that none of these modern sequences is
equal to the sequence obtained fromthe fossil extracts. Since we used
different sets of overlapping primers pairs to amplify the fragment
included between nucleotide 16024 and 16383, it seems highly
unlikely that the sequence obtained was a chimera artefact.
Therefore, at this stage it is safe to conclude that at least one Cro-
Magnoid mtDNA sequence, for which contamination can be ruled
out with a high degree of confidence, falls well within the range of
modern human variation. This does not prove, but at least indirectly
suggests, that the previously published Cro-Magnoid sequences [15],
both documented in the modern human gene pool, may be genuine
[31]. At any rate, the finding of the Cambridge Reference Sequence
in Paglicci 23 shows that one of today’s mtDNA variants has been
present in Europe for at least 28,000 years, and that modern and
archaic anatomical features appear associated with mtDNA
sequences that can be classified, respectively, as modern and
nonmodern.
Because no HVR I sequence similar to the Neandertals’ has
been described in more than 4800 Europeans studied so far [32],
models whereby Neandertals were part of the genealogy of current
Europeans are at odds with the data, at least as far as maternal
inheritance is concerned. In our opinion, the burden of the proof is
now on those who maintain that Neandertals might have
contributed to the modern gene pool.
So far, the study of ancient nuclear DNA in humans has been
severely limited by the difficulty to ascertain whether the DNA
sequences obtained are really endogenous to the specimen. This
study shows that it is possible to test for DNA authenticity, provided
the people who manipulate the sample from the moment of
excavation are carefully recorded and their DNAs typed. Therefore,
Paglicci 23 (as well as other remains studied under comparable
conditions in the future) promises to be a valuable source of
information on DNA diversity in the past, and can pave the ground
for a more exhaustive understanding of human evolutionary history.
Materials and Methods
DNA extraction
All DNA-preparation and extraction methods followed strictly
specific ancient DNA requirements [33]. DNA was extracted in
Table 1. Mitochondrial HVR1 variation in the seven
researchers that have been in physical contact with the
samples.
Researcher Task HVR1 haplotype
F.M Excavation 16069 T, 16126 C, 16278 T, 16294 T, 16366 T
S.V Laboratory analysis 16311 C
A.M Laboratory analysis 16274 A 16311 C
M.L Laboratory analysis 16261 T, 16311 C
E.Pi Laboratory analysis 16096 A, 16126 C, 16145 A, 16189 C,
16231C, 16260 T, 16261 T,
C.L. Laboratory analysis 16126 C, 16294 T, 16296 T, 16304 C
D.C. Laboratory analysis 16193 T, 16278 T
doi:10.1371/journal.pone.0002700.t001
Figure 2. Genetic relationships among the Paglicci 23 and
other relevant mtDNA sequences. The network summarizes
mtDNA HVR I variation in 13 Neandertals (Nea1 to Nea13) , three Cro-
Magnons (CrM1 to CrM3), and seven modern humans who manipulated
the Cro-Magnons specimens (six authors of this paper and Carles
Laueza-Fox, designated by their initials).
doi:10.1371/journal.pone.0002700.g002
Cro-Magnon Mitochondrial DNA
PLoS ONE | www.plosone.org 3 July 2008 | Volume 3 | Issue 7 | e2700
two laboratories, in Florence and Barcelona, in facilities
exclusively dedicated to ancient DNA work. All DNA extractions
and PCR set up were carried out in physically separated spaces
from those in which PCR cyclings and post-PCR analysis was
conducted. Full-body suits, disposable masks and gloves were worn
throughout and were changed frequently, and pipettors were
UVirradiated
in between use. All DNA extractions and PCR reactions
included negative controls, and all steps of the analysis were
replicated at least twice in each laboratory. To test for preservation
of
other macromolecules as an indirect evidence for DNA survival [26]
we estimated the degree of aminoacid racemization, in each sample,
using approximately 5 mg of tibia and skull, powdered following the
procedures described in [25]. We quantified the amount of target
DNA by Real Time (RT) PCR. PCR products were cloned, 152
clones were sequenced, and the sequences thus obtained were
aligned and compared across clones. After extraction, UNG
treatment were performed on a third skull fragment in order to
verify whether C to T changes (nt 16294 ) observed in some clones
represented postmortem damage or contamination [17].
To prevent contamination from prior handling, the outer layer
of bones was removed with a rotary tool, and the fragments were
briefly soaked in 10% bleach. Both samples were then irradiated (1
hour under UV light) and powdered. DNA was extracted by
means of a silica-based protocol [15]. At least two independent
extracts were obtained from each remain. Multiple negative
controls were included in each extraction.
UNG treatment
Uracil bases caused by the hydrolytic deamination of cytosines
were excised by treating 10 ml of DNA extracted from both
samples with 1U of Uracil-N-Glycosylase (UNG) for 30 min at
37uC. UNG reduces sequence artefacts caused by this common
form of post-mortem damage, resulting in apparent C to T/G to A
mutations and subsequent errors in the sequence results [17]. After
this treatment, the extract was subjected to the same PCR Cloning
and sequencing conditions as described above.
Quantification of DNA Molecules
Real-time PCR amplification was performed using BrilliantH
SYBRH Green QPCR Master Mix (Stratagene) in MX3000P
(Stratagene), using 0.5mM of appropriate primers (forward primer
located at H 16107 and reverse primer located at L 16261.
Thermal cycling conditions were 95uC for 10 min, 40 cycles at
95uC for 30 s, 53uC for 1 min and 72uC for 30 s, followed by
SYBRH Green dissociation curve steep. Ten-fold serial dilutions of
the purified and quantified standard were included in the
experiment to create the standard curve in order to know the
number of initial DNA molecules in the samples
Amplification of mt DNA
Two ml of DNA extracted from the bone were amplified with
this profile: 94uC for 10 min (Taq polymerase activation), followed
by 50 cycles of PCR (denaturation , 94uC for 45 sec, annealing,
53uC for 1 min and extension, 72uC for 1 min) and final step at
72uC for 10 min. The 50 ml reaction mix contained 2 U of
AmpliTaq Gold (Applied Biosystems), 200 mM of each dNTP and
1 mM of each primer. The 360 bp long HVR-I was subdivided in
three overlapping fragments using the following primer pairs:
L15995/H16132; L16107/H16261; L16247/H16402. Each extract
was amplified at least twice. Since overlapping primers were
used throughout the PCR amplifications, it is highly unlikely that
we amplified a nuclear insertion rather than the organellar
mtDNA. Reactions conditions in replay analysis were described in
[34], except for the sequences primers that we report as follows:
59ACTATCACACATCAACTGC 39; 59ATGGGGACGAGAAGGGATTT
39.
Cloning and Sequencing
PCR products were cloned using TOPO TA Cloning Kit
(Invitrogen) according to the manufacturer’s instructions. Screening
of white recombinant colonies was accomplished by PCR,
transferring the colonies into a 30 ml reaction mix (67 mM Tris
HCl [pH 8.8], 2 mM MgCl2, 1 mM of each primer, 0.125 mM of
each dNTP, 0,75 units of Taq Polymerase) containing M13
forward and reverse universal primers. After 5 min at 92u C, 30
cycles of PCR (30 sec at 90uC, 1 min at 50uC, 1 min at 72uC)
were carried out and clones with insert of the expected size were
identified by agarose gel electrophoresis. After purification of these
PCR products with Microcon PCR devices (Amicon), a volume of
1,5 ml was cycle-sequenced following the BigDye Terminator kit
(Applied Biosystems) supplier’s instructions. The sequence was
determined using an Applied BioSystems 3100 DNA sequencer.
‘‘Long’’ amplificate detection
Appropriate molecular behaviour was also tested by amplification
of longer mtDNA fragments (443 bp and 724 bp), which have
been reported as very unusual for ancient DNA. PCR conditions
were those described for mtDNA analysis above, primers used for
443 bp fragment were L15995 and H16401, while for 724 bp
fragment primers used were L16247 and H00360.
Amplification with Neandertal-specific primers
Amplifications of the Paglicci extracts with two pairs of
Neandertal-specific primers (L16,022-NH16,139 and NL16,263/
264-NH16,400, [14]) were also attempted. 50 ml of DNA were
amplified with the following profile: 94uC for 10 min and 45 cycles
of a denaturation (94uC for 45 sec), annealing (57uC for 1 min for
the first couple and 59uC for 1 min for the second couple) and
extension step (72uC for 1 min). The 50 ml reaction mix contained
2 U of AmpliTaq Gold polymerase and 16 reaction buffer
(Applied Biosystems), 200 mM of each dNTP, 1.5mM MgCl2,
1 mM of each primer.
Extractions amplifications and sequencing of modern
DNA
MtDNA genotypes of all individuals who had any contacts with
the specimen were either known in advance (M.L., D.C. and
C.L.F: [21]), or determined in the Laboratory at Viote Trento
(S.V., E.Pi., A.M., F.M.). Buccal cells were collected by oral
brushes (Sterile Omni Swab or Sterile Foam Tipped Swabs,
Whatman International Ltd., Maidstone, UK) and DNA was
extracted using QIAmp1 DNA Mini Kit (QIAGEN, Hagen,
Germany) according to manufacturer’s instructions. The hypervariable
region I (HVR1) of the mtDNA was determined by PCR
amplification using the primers L15996 (59CTCCACCATTAGCACCCAAAGC
93) and H408 (59 CTGTTAAAAGTGCATACCGCC
93) (Table S1).
Supporting Information
Table S1 Sequences of the clones obtained by amplifying the
HVR I of mtDNA from the Paglicci 23 fossil. A dot indicates
identity with respect to the Cambridge Reference Sequence, as
modified by Ruiz-Pesini et al. [26], a letter indicates a nucleotide
substitution. In the first column, labels designate clones sequenced,
respectively, in the Florence (those beginning with an F) or
Barcelona (those beginning with a B) laboratories. Bold type: clone
Cro-Magnon Mitochondrial DNA
PLoS ONE | www.plosone.org 4 July 2008 | Volume 3 | Issue 7 | e2700
sequences after UNG treatment. The sequences of the primers are
also reported.
Found at: doi:10.1371/journal.pone.0002700.s001 (0.09 MB
DOC)
Acknowledgments
We would like to thank Carles Lalueza Fox, who replicated the
sequences
in his laboratory at the University Pompeu Fabra, Barcelona, Spain,
and
Agnar Helgason for his comments and suggestions.
Author Contributions
Conceived and designed the experiments: DC GB. Performed the
experiments: LM SV AM EP MG EP ML AC. Analyzed the data: GB
GB. Wrote the paper: DC FM GB. Collected the sample: BL FM. Dated
the sample: BL AR. Participated in preliminary tests of macromolecule
preservation: AC.
References
1. Mellars P (2006a) A new radiocarbon revolution and the dispersal of
modern
humans in Eurasia. Nature 439: 931–935.
2. Zilha˜o J (2006) Neandertals and moderns mixed, and it matters.
Evol Anthropol
15: 183–195.
3. Stringer C (2002) Modern human origins: progress and prospects.
Philos
Trans R Soc Lond B Biol Sci 357: 563–579.
4. Relethford JH (2001) Absence of regional affinities of Neandertal
DNA with
living humans does not reject multiregional evolution. Am J Phys
Anthropol 115:
95–98.
5. Relethford JH (2007) Genetic evidence and the modern human origins
debate.
Heredity 100: 555–563.
6. Wolpoff MH (2005) Multiregional Evolution. In: Renfrew C, Bahn P,
eds.
Archaeology: The Key Concepts. London: Routledge. pp 176–181.
7. Manica A, Amos W, Balloux F, Hanihara T (2007) The effect of
ancient
population bottlenecks on human phenotypic variation. Nature 448: 346–
348.
8. Krings M, Capelli C, Tschentscher F, Geisert H, Meyer S, et al.
(2000) A view of
Neandertal genetic diversity. Nat Genet 26: 144–146.
9. Lalueza-Fox C, Krause J, Caramelli D, Catalano G, Milani L, et al.
(2006)
Mitochondrial DNA of an Iberian Neandertal suggests a population
affinity with
other European Neandertals. Curr Biol. 16: R629–R630.
10. Currat M, Excoffier L (2004) Modern humans did not admix with
Neanderthals
during their range expansion into Europe. PLoS Biol. 12: e421.
11. Liu H, Prugnolle F, Manica A, Balloux FA (2006) Geographically
explicit
genetic model of worldwide human-settlement history. Am J Hum Genet
79:
230–237.
12. Ramachandran S, Deshpande O, Roseman CC, Rosenberg NA, Feldman MW,
et al. (2005) Support from the relationship of genetic and geographic
distance in
human populations for a serial founder effect originating in Africa.
Proc Natl
Acad Sci USA 102: 15942–15947.
13. Mellars P (2006b) Going east: New genetic and archaeological
perspectives on
the modern human colonization of Eurasia. Science 313: 796–800.
14. Caramelli D, Lalueza-Fox C, Condemi S, Longo L, Milani L, et al.
(2006) A
highly divergent mtDNA sequence in a Neandertal individual from Italy.
Curr.
Biol. 16: R630–R632.
15. Caramelli D, Lalueza-Fox C, Vernesi C, Lari M, Casoli A, et al.
(2003) Evidence
for a genetic discontinuity between Neandertals and 24,000-year-old
anatomically
modern Europeans. Proc Natl Acad Sci USA. 100(11): 6593–7.
16. Serre D, Langaney A, Chech M, Teschler-Nicola M, Paunovic M, et
al. (2004)
No evidence of Neandertal mtDNA contribution to early modern humans.
PLoS
Biol 3: E57.
17. Hofreiter M, Jaenicke V, Serre D, van Haeseler A, Pa¨a¨bo S (2001)
DNA
sequences from multiple amplifications reveal artifacts induced by
cytosine
deamination in ancient DNA Nucleic Acids Res 29: 4793–4799.
18. Malmstro¨m H, Stora° J, Dale´n L, Holmlund G, Go¨therstro¨m A
(2005) Extensive
human DNA contamination in extracts from ancient dog bones and teeth.
Mol
Biol Evol 10: 2040–2047.
19. Salamon M, Tuross N, Arensburg B, Weiner S (2005) Relatively well
preserved
DNA is present in the crystal aggregates of fossil bones. Proc Natl
Acad Sci USA
39: 13783–13788.
20. Lalueza-Fox C, Sampietro ML, Caramelli D, Puder Y, Lari M, et al.
(2005)
Neandertal evolutionary genetics: mitochondrial DNA data from the
Iberia
peninsula. Mol Biol Evol 22: 1077–81.
21. Sampietro ML, Gilbert MT, Lao O, Caramelli D, Lari M, et al.
(2006) Tracking
down human contamination in ancient human teeth. Mol Biol Evol 23:
1801–1807.
22. Gilbert MTP, Rudbeck L, Willerslev E, Hansen HJ, Smith C, et al.
(2005)
Biochemical and physical correlates of DNA contamination in
archaeological
human bones and teeth excavated at Matera, Italy. J Archaeol Sci 32:
783–95.
23. Gilbert MTP, Hansen AJ, Willerslev E, Turner-Walker G, Collins M
(2006)
Insights into the processes behind the contamination of degraded human
teeth
and bone samples with exogenous sources of DNA. Int J Osteoarcheol
16(2):
156–64.
24. Mallegni F (2005) Catalogue of Italian fossil human remains from
the
Palaeolithic to the Mesolithic. J Anthropol Sci 84 (Suppl.): 110.
25. Poinar HN, Hoss M, Bada JL, Pa¨a¨bo S (1996) Amino acid
racemization and the
preservation of ancient DNA. Science 272: 864–866.
26. Handt O, Krings M, Ward RM, Pa¨a¨bo S (1996) The retrieval of
ancient human
DNA sequences. Am J Hum Genet 59: 368–376.
27. Ruiz-Pesini E, Lott MT, Procaccio V, Poole J, Brandon MC, et al.
(2007) An
enhanced MITOMAP with a global mtDNA mutational phylogeny. Nucleic
Acids Res 35: D823–D828.
28. Templeton AR, Crandall KA, Sing CF (1992) A cladistic analysis of
phenotypic
associations with haplotypes inferred from restriction endonuclease
mapping and
DNA sequence data. III. Cladogram estimation. Genetics 132: 619–633.
29. Clement M, Posada D, Crandall KA (2000) TCS: a computer program to
estimate gene genealogies. Mol Ecol 9: 1657–19.
30. Abbott A (2003) Anthropologists cast doubt on human DNA evidence.
Nature
423: 468–468.
31. Barbujani G, Bertorelle G (2003) Were Cro-Magnons too like us for
DNA to
tell? Nature 424: 127.
32. http://web.unife.it/progetti/genetica/pdata.htm/PopList.xls.
33. Cooper A, Poinar H (2000) Ancient DNA: do it right or not at all.
Science 289:
1139.
34. Sampietro ML, Lao O, Caramelli D, Lari M, Pou R, et al. (2007)
Palaeogenetic
evidence supports a dual model of Neolithic spreading into Europe.
Proc Biol Sci
274: 2161–2167.
Cro-Magnon Mitochondrial DNA
PLoS ONE | www.plosone.org 5 July 2008 | Volume 3 | Issue 7 | e2700 SOURCE

PRE-CLOVIS IN WISCONSIN Options

Wooly mammoth skeletons that were found on the John Hebior farm in
Kenosha, Wisconsin had primitive stone knives found in connection with
them which were used to scrape meat from the bones of the mammoths.
The mammoth bones which have knife cut marks on them have been dated
to 12,500 BCE and thus, the knives are Pre-Clovis and in Wisconsin.
This is another piece of evidence that humans were in North America
before the last Ica Age.


WISN.com, a Milwaukee ABC affliate, has the story here and a video of
the broadcast of the story;


Full Length Video

Another possible piece of testimony for sea travel in Paleolithic

Another possible piece of testimony for sea travel in Paleolithic
times?

July 27, 2008
Flint hints at existence of Palaeolithic man in Ireland
200,000 year-old flaked flint is certainly of human workmanship, but
its ultimate origin remains uncertain
Norman Hammond
Archaeology Correspondent


The possibility of a Palaeolithic human presence in Ireland has once
again presented itself. A flaked flint dating to about 200,000 years
ago found in Co Down is certainly of human workmanship, but its
ultimate origin remains uncertain.


Discovered at Ballycullen, ten miles east of Belfast, the flake is
68mm long and wide and 31mm thick. Its originally dark surface is
heavily patinated to a yellowish shade, and the lack of sharpness in
its edges suggests that it has been rolled around by water or ice, Jon
Stirland reports in Archaeology Ireland.


Dr Farina Sternke has identified it as a classic Levallois-type flake
from the rejuvenation of a flint core; such flakes are characteristic
of stone-tool industries made by archaic humans of the pre-Neanderthal
era, as technology moved towards making multiple flakes from one core
and then trimming them into a variety of different tool types.


The date assigned of between 240,000 and 180,000 years matches a
similar flake discovered by the late Professor Frank Mitchell near
Drogheda, Co Louth, 40 years ago, which has until now been the only
uncontested Palaeolithic tool from Ireland.


The problem, as with the Drogheda flake, lies in the context: the
Ballycullen specimen was shown to have come from a drumlin mound,
deposited by glacial activity. The last such activity in Co Down was
about 16,000 years ago, and the ice sheet had spread west from
Scotland.


Other materials in the drumlin led Dr Ian Mitchell, of the Geological
Survey of Northern Ireland, to suggest that the flake could have been
transported “a significant distance, from eastern Antrim, from the sea
bed in the North Channel, or even from the West Coast of Scotland”,
the same conclusion that Professor Mitchell came to about the Drogheda
specimen in 1968. So the evidence for the earliest Irish remains
enticing, but tenuous.


Archaeology Ireland Vol. 22 No. 1: 23-24
Below the pictorial web page at the link are related articles
including the Alexeev Harvard Lectures on African remains in Russia
from 27,000 years ago. Women wear what anthropologist have determined
is a weaved hat from that era.

http://www.beforebc.de/Related.Subjects/The.Gold.Age/51-10-60-01.html


Text from the web page above:


Depending on the measure, the human being has existed for 7 million
years. For all the concern over proper dress, we have been unclothed
for 7 million years minus only the last 7,000 years. Part A: a - h,
e.g., shows that from the first human sculpture, the Venus of
Willendorf (b) 25,000 BC until, roughly, the Moldavian Venus (h) of
6000 BC, the human being went about naked.


Part B: 1 - 7 gives an encapsulation of the history of weaving, cloth-
making, and clothes-making. Steatophygia is a trait associated with
African women. The archeological record leaves us the evidence that it
is these African women (B: 1c, 2d, 4c, 5c, 8d-e) and others present at
the place and time textile-making was being created (B: 3b, 4b-d, 6c,
7b) who were involved in the invention and spread of the tradition of
cloth-making to humanity.


HISTORY: the weaving of thread twining it by hand was the first stage
of clothmaking. It was followed by the use of the spindle (or whorl) -
a donut-shaped object (B: 1a, 2a, 3a, 4a, 6a-b, 7a).


EVOLUTION: We can trace the evolution of technology of textile-making
in some locations as Egypt (3a to 3c); Greece (4a - 4d); Mexico (7a -
7c). We also see that dresses are the same today as they were when
first made with, apparently, soft materials and dyed patterns as in
the dress from Hacilar, Turkey (B: 1c) almost 9000 years ago or Greece
(B:4c) some 8000 years ago.


WHO MADE, HOW MUCH, WHO WORE? Three dozen times in Homer’s Iliad and
Odyessy, we read of queens and noble women weaving cloth. At the
beginning, it is only royalty who had the time and right (as it were)
to wear clothes. Over the millenniums, it became something for the
masses and Madison Avenue.


Marc Washington

Tuesday, July 15, 2008

Researcher Leads Underwater Archeological Expedition In Gulf of Mexico

Researcher Leads Underwater Archeological Expedition In Gulf of Mexico
in Search of First Americans


July 14, 2008


E-mail this article


AUSTIN, Texas — C. Andrew Hemmings, research associate of the Texas
Archeological Research Laboratory (TARL) at The University of Texas at
Austin, will lead an underwater archeological expedition July 30 to
Aug. 12 in the Gulf of Mexico to search for submerged evidence of the
first Americans.


Hemmings and James Adovasio, director of the Mercyhurst College
Archaeological Institute in Erie, Pa., who serves as co-principal
investigator of the project, will study ancient submerged coastlines
in the northeastern Gulf to determine where early Americans, known as
the Clovis culture, might have lived more than 12,000 years ago when
the underwater terrain was dry land.


"The archeological record is out there, it's just underwater,"
Hemmings said. "The study's findings will contribute to our
understanding of early humans in North America, including the timing
of their arrival, lifestyles and migration patterns, and could add
further proof that the peopling of the western hemisphere was a
lengthier and more complicated process than is typically believed."


The expedition has earned more than $200,000 in grant support,
including $100,000 from the National Oceanic and Atmospheric
Administration. Additional supporters include TARL, the Gault School
of Archaeological Research in Austin, Florida Bureau of Archaeological
Research, Florida Geological Survey, Mercyhurst College and the
University of South Florida.


Hemmings and the 12-person research team will embark July 30 on the
University of South Florida's research vessel "Suncoaster" to explore
an area near the Florida Middle Grounds 100 to 200 miles off Florida's
west coast at depths of 40 to 110 meters. Archeological finds
uncovered by past dredging operations, fishermen and geologists point
to the area's potential to have hosted human inhabitants long ago, the
researchers said.


In shallow depths, divers will inspect sites to collect artifacts and
recover soils for radiocarbon dating. At deeper locations, the
research team will use remotely operated vehicles and remote sensing
tools to explore submerged sites and search for fossil remains and
stone artifacts.


"We will start our investigation in shallow areas available to Clovis
people 12 to 13,000 years ago, and then proceed to older, deeper
landscapes that could have only been inhabited by people older than
Clovis," Hemmings said.


To learn more about TARL's investigation of Clovis culture at other
sites in Texas, read the feature story "Can You Dig It?: Archeologist
works to overturn long-held theory of when people first came to the
Americas."


More information about Clovis people is available at
TexasBeyondHistory.net, a virtual museum produced by TARL, in the
exhibit "Clovis Reconsidered."


For more information, contact: Jennifer McAndrew, College of Liberal
Arts, 512-232-4730; C. Andrew Hemmings, research associate, Texas
Archeological Research Laboratory, 620-757-4111.
Source Article

Sunday, July 13, 2008

Loud and clear

Loud and clear
By Tia Ghose
July 7th, 2008
Web edition


Fossil finds suggest an early origin for human speech


ALL EARSCT scanning of H. heidelbergensis skulls, like the one shown
here, helped a team reconstruct the structure of the ear canal of this
Neandertal ancestor. The skulls, more than 530,000 years old, were
found at the Sima de los Huesos site in Atapuerca, Spain.Quam et al


It may be time to rethink the stereotype of grunting, wordless
Neandertals. The prehistoric humans may have been quite chatty — at
least if the ear canals of their ancestors are any indication.


The findings suggest human speech may have originated earlier than
some researchers contend. Anthropologists disagree about whether
language sprang up rapidly around 50,000 years ago or emerged more
gradually over a longer period of time, says Rolf Quam, a
paleoanthropologist at the American Natural History Museum in New York
and coauthor of the new study.


The auditory bones of 530,000-year-old skulls indicate that an early
human species called Homo heidelbergensis may have heard sounds much
the way people do today. H. heidelbergensis are thought to be an
ancestor of Neandertals. The findings could reignite debate about
whether Neandertals could speak, Quam and colleagues report. The study
is the first to use a fossil to reconstruct sensory perception in any
Homo species, they add.


The skulls are from a site in Atapuerca, Spain called Sima de los
Huesos, or “pit of the bones.” The Atapuerca research team, which
includes members from many disciplines and universities, used CT
scanning of the skulls to reconstruct the size and shape of the ear
canals, Quam says.


CHART
NOT HARD OF HEARINGLike in modern humans (shown in solid blue), the
ear canal of H. heidelbergensis (shown in red and magenta lines) had a
peak in auditory sensitivity in the frequency range from 2 kilohertz
to 4 kilohertz, where much spoken information is transmitted.
Chimpanzees (shown in solid green) have a dip in sensitivity in that
range. Quam et al


The length of the ear canal determines what frequencies of sound waves
resonate, and are therefore heard more easily, says Sunil Puria of
Stanford University, who models hearing patterns from ear structure.


The geometry of the ear canal reveals that the hearing patterns of H.
heidelbergensis overlapped with those of modern-day humans. Both
modern people and the ancient hominids have especially sharp hearing
in the 2 kilohertz to 4 kilohertz frequency range, where much of the
sound energy of spoken language is transmitted.


Chimpanzees, the closest living relatives of Homo sapiens, by
contrast, have a dip in sensitivity around 4 kilohertz, says Mark
Coleman of Midwestern University’s campus in Glendale, Ariz. Coleman
studies primate hearing but was not involved in the study. “Of course
primates can differentiate sounds related to speech — so can my dog —
the key is that humans appear to have a maximum sensitivity in the
range that contains a lot of overtones in speech.”


The results don’t necessarily show that the ancient humans could
speak, Quam says. “We're saying that the ear changed for some reason
and that those changes facilitated the possibility of language
development,” he says. The team reported the findings July 3 in Paris
during the Acoustics ’08 conference.


Researchers have long tried to determine whether Neandertals could
speak by reconstructing their vocal tracts, Quam says. But soft tissue
makes up most of the voice box, so few traces remain in the fossil
record. The ear is a better candidate because the bony structure
reveals more about hearing capacity.


But, says Coleman, the model Quam and colleagues used to reconstruct
the ear requires researchers to input many different variables —
including characteristics such as the elasticity of ligaments that are
no longer present in the fossils. “You kind of have to make some
assumptions, and I worry that at some point the assumptions of the
models are going to break down.”


If H. heidelbergensis did have modern hearing capacity, however, it’s
logical to assume they had a primitive form of human communication, he
adds. Though it’s possible that H. heidelbergensis could hear in that
frequency range but didn’t use that ability for anything special,
“sensory systems are extremely neurologically expensive,” Coleman
says. It’s unlikely that the body would invest the resources in
maintaining such a system if it didn’t serve a purpose, he says.


The research comes on the heels of an April Molecular Biology and
Evolution study showing that Neandertals had two genes that are
similar to those implicated in language development in humans but
differ from those in chimpanzees.

http://www.sciencenews.org/view/generic/id/33933/title/Loud_and_clear

Who were B.C.’s first seafarers?

Who were B.C.’s first seafarers?
By Daniel Wood
Publish Date: July 10, 2008


Even pale ink is better than memory—Chinese proverb
Chinese myths and tenuous archaeological evidence offer hints that
explorers came here from the Far East long ago


As the tide creeps over the sand flats of Pachena Bay south of
Bamfield, it brings ashore flotsam of the Pacific Ocean that—on
occasion—hints at extraordinary travels and a mystery of historic
proportions.


Amid the kelp, in decades past, hundreds of green glass fishnet floats
arrived intact on Vancouver Island’s west coast, having ridden the
powerful Japan Current in yearlong transits from Asia. But on much
rarer occasions, the current and tide have brought to North America’s
west coast the boats of unintentional Asian voyagers, most of them dead
—the victims of dismastings 10,000 kilometres away.


Even more rarely, these ghost ships carried survivors of this slow
drift, men who spoke Chinese or Japanese. Such was the case with the
Hy?jun Maru, which was left rudderless in a typhoon off Japan and
drifted for 14 months before washing up in 1834 on Washington state’s
Cape Flattery headlands, just across from Pachena Bay. It contained
three fishermen.


It is, in fact, one of 100 known Asian drift boats that have crossed
the Pacific accidentally. (The last one to arrive came ashore on the
Queen Charlotte Islands in 1987, empty.) But no one knows what to make
of the evidence hauled up from the wreck that lies 16 kilometres off
Pachena Bay in almost 150 metres of water, or the two supposed wrecks
that are purported to have yielded strange artifacts from beneath
nearby Clayoquot Sound. For all three have produced barnacle-covered
Asian pots—probably Chinese—whose age may predate the earliest
European visitors to this coast.


No one knows how to explain the source of early iron implements in the
Pacific Northwest—where iron was unknown to its inhabitants—or the
origin of the 100 Asian plants and human parasites that suddenly
appeared in Latin America a few millennia ago, or the recently
revealed linguistic similarities between early Chinese and Mayan
words.


How did the bones of chickens—an Asian fowl—get into a prehistoric
American midden? What explains the similarities between Japanese and
Zuni blood types? And no one can figure out how the 1,500-year-old
Chinese legend of Fu Sang could have come about.


It recounts the journey of Chinese adventurer and Buddhist missionary
Hui Shen, who claimed to have sailed across the Pacific, along the
coast of what is today called British Columbia, then southward to a
subtropical place he called Fu Sang. Many of the details in his
chronicle of this 40-year journey are breathtakingly accurate.


Where does coincidence end and incident begin? Were people crossing
the Pacific long before Europeans crossed the Atlantic?


In the past 100 years, a lot of Eurocentric views of history have
collapsed, and a lot of stories once viewed as fantastical have proven
true. Not long ago, no one guffawed when schoolteachers intoned that
Johann Gutenberg invented the printing press and Christopher Columbus
“discovered” America. Believing these things was part of the conceit
of European superiority.


This view extended to old myths and legends that 20th-century
academics dismissed as the imaginings of primitive minds. The Vinland
saga was a tale told by uncouth Vikings, and nothing more. Atlantis
was something Plato dreamed up. A lost Incan city somewhere in the
Andes? How romantic.


But today there are Newfoundland’s L’Anse aux Meadows and the Greek
island of Santorini and Peru’s Machu Picchu to remind the dogmatic
that the ink of history is not indelible, that history is, in fact, a
palimpsest of rewritings, as new discoveries obscure old beliefs.


No person has been more influential—or, in his conclusions, more wrong—
in exploring the possibility of early trans-Pacific travel than the
late Norwegian adventurer Thor Heyerdahl. He’s the man behind the 1947
Kon-Tiki raft expedition, widely considered one of the greatest feats
of human endurance in history.


Few know that Heyerdahl’s famous ocean-crossing raft journey had its
origins in Bella Coola, B.C., in 1939, when the young anthropologist
spent the winter there looking for evidence that might link Natives of
the Americas to ancient cross-Pacific human migrations.


Curiously, the first clues to this supposition were reports he heard
from Bella Coola fishermen of glass Japanese fishnet floats entangled
in their nets, and the equally provocative anthropomorphic petroglyphs
at nearby Thorsen Creek. To his mind, the big-eyed stone creatures
depicted there were identical to ones he’d seen previously in Hawaii
and on Easter Island, far out in the Pacific off Chile.


Could it be, he asked himself, that the endlessly circling ocean
currents that were bringing Japanese fishing floats to B.C.’s central
coast at Bella Coola had also carried early westbound Native Americans
to Polynesia? Perhaps the Pacific was not an impediment to prehistoric
mariners but an invisible river?


With his successful east-to-west, 8,000-kilometre journey on the Kon-
Tiki, an important new vista opened for scientific investigation:
people could have utilized primitive vessels to cross the Pacific.
(Heyerdahl’s error—and it was a huge one—was to assume these ocean
migrations originated in the Americas, not in Asia.)


In the late summer of 1979, captain Mike Tyne, then 31, was fishing
with his trawler the Beaufort Sea above Big Bank, a shallows off
Pachena Bay at the western border of Juan de Fuca Strait, when his
dragnet hauled up an unusual catch. Amid the cod and sole were pieces
of rotten wood and a large, intact, brown-glazed pot, its exterior
encrusted with marine-worm casts and its interior holding an octopus.


The three-man crew discussed the likelihood they’d snagged an unknown
shipwreck 150 metres below. The wood was promptly discarded, but Tyne
told himself the urn would make a good planter for his wife, Patsy,
and brought his find back to Ucluelet. Word got around town that Tyne
had pulled up an old, Chinese-looking pot, and speculation began—and
continues to this day—that Tyne had found the first evidence of an
ancient Asian shipwreck on the North American coast. There were
stories in the local paper. An American visitor offered him $2,000 for
the pot. Archaeologists appeared.


During the next few years, as news of the 75-centimetre-high urn
circulated, three institutions provided differing assessments of its
age. According to Tyne, the British Museum in London said, based on
photographs, that it was probably 300 years old; both the University
of Toronto and UBC, using carbon dating, said it could be 700.


However, no one could confirm its significance. Even if it were a very
old Chinese urn, there was no proof the wreck itself was the same age.
With an estimated 2,000 sunken ships along the B.C. coast—most
unsurveyed—the old pot could have been carried on an unknown 19th-
century vessel that foundered off Pachena Bay. But uncertainty about
the pot’s origins did little to deter interest.


As a boy in Grade 5, Tom Beasley, now 54 and a Vancouver lawyer, read
Thor Heyerdahl’s famous book Kon-Tiki: Across the Pacific by Raft and
was fired by the anthropologist’s conviction that the Pacific was a
crossroads of ancient travel. Beasley learned to dive, studied
maritime histories and Pacific Northwest folklore, joined the
Underwater Archaeological Society of B.C., and came to believe that
the B.C. coast held myriad secrets.


In 1983 in Tofino, searching for the sunken 19th-century fur-trading
vessel Tonquin, he watched as a man stepped onto his tugboat with a
barnacle-covered Chinese pot. Robert Pfannenschmidt, a Tofino forestry
employee and diver, claimed that it came from a second Asian wreck in
nearby Clayoquot Sound. He refused, however, to reveal the location of
his alleged discovery, saying he was keeping the shallow-water site
secret in order to extract its artifacts at a later date.


(Beasley and others informed Pfannenschmidt at that time that
pillaging a historic shipwreck in B.C. is illegal, and he has since
rejected interview requests.) Not long after that, two more old
Chinese pots appeared in fishnets off Tofino, prompting reports of a
third Asian wreck.


To Beasley’s mind, these underwater pottery finds were further clues
that Chinese voyagers reached North America long ago. And he lists a
few of the other curious linkages: B.C. Native myths of non-European
strangers arriving from the sea; conical hats common to Asians and
local Natives; the use of mortuary poles on both sides of the Pacific
(and nowhere else); and the profoundly odd story of Fu Sang.


“The story line is wonderful,” he says of the mounting evidence that
ocean-crossing Asian travellers did, in fact, venture here. “All we’ve
got so far is pieces of the puzzle. We have to follow the myths. Fu
Sang’s like the old Norse sagas describing Vinland. Now…with L’Anse
aux Meadows, we know the sagas were correct: the Vikings got to the
New World 500 years before Columbus. But here…we haven’t found the
Holy Grail: the shipwreck. But it will be found!”


The idea that the Chinese may have reached the New World at least 500
years before the Vikings and 1,000 years before Columbus is as
tantalizing as it is controversial. In Liang-shu (Records of the Liang
Dynasty), set down almost 1,500 years ago, the story is told of an
itinerant monk named Hui Shen who set sail with his four Buddhist
companions on a four-decade-long, trans-Pacific odyssey with the
intention of introducing their religion to the peoples they
encountered across the “Great Eastern Sea”.


Utilizing the Japan Current, the legend reports, the men travelled
from China 4,000 kilometres northeast, to a land where people had
striped faces. The direction, distance, and details fit remarkably
with the tattooed Aleuts of southern Alaska. Hui Shen then sailed
2,700 kilometres farther east and south to a land of “mile high” trees
where wooden houses were surrounded by decorations. He called the
place the Great Land of Rushing Waters.


Again, in distance, direction, and details, it sounds like British
Columbia. Continuing south, the men journeyed 10,600 kilometres to a
country the monk called Fu Sang after local trees that produced a red,
pear-shaped fruit. The people, he reported, had a rich culture, with
an aristocracy, a writing system, complex rituals, and domestic
animals that today suggest Mayan Mexico. Again, things fit almost
perfectly. Hui Shen returned to China in AD 499, only to find his
homeland racked by civil war.


Some elements of the Fu Sang story are, however, so odd that critics
dismiss the account as the product of imagination. Hui Shen reported
he heard stories in Fu Sang of a nearby society composed exclusively
of Amazonian women who took snakes as husbands and nursed their
children from nipples on their shoulders.


He said he saw deer pulling wheeled carts, and dog-faced men. Time and
transcription can, of course, turn gods into dogs. Such is the nature
of myth. But no less an authority than British Sinologist Joseph
Needham counted, on visits to Mayan Mexico, more than 100 parallels—in
complicated rain-making ceremonies, in the construction of suspension
bridges, and in a belief in the magical properties of jade—that
indicated the two civilizations had ancient links.


Until quite recently, most North American archaeologists would get
nervous at the suggestion that ancient Asian mariners crossed the
Pacific in travels to the Americas. Trapped in a scientific orthodoxy—
not so different from the one dictating that early-20th-century
geologists reject the new (and now firmly established) theory of
drifting continents—archaeologists have claimed that the early
cultures of the Americas evolved untainted by any outside influence.


This belief had its roots in a sort of über-nationalism of western
scientific thought: unlike the mongrel cultures of Asia, Melanesia,
and Africa, so the argument went, there was no foreign miscegenation
in the Americas. This smug, isolationist idea held sway for most of
the 20th century.


A map of North American that was created in France in 1792 contains
the intriguing words Fousang des Chinois in the area where B.C. exists
today.


So Heyerdahl’s Kon-Tiki demonstration of an alternative theory—that
the Pacific may have been a highway of ancient American-Asian
diffusions—was greeted with derision by academia. Then came Gavin
Menzies’s best-selling 2002 book 1421: The Year China Discovered the
World, describing alleged Oriental visits to the New World almost 600
years ago. Historians and archaeologists went ballistic.


Menzies is a liar, they said. Worse, he’s a charlatan. What often got
lost in the tirades against Menzies and his mistaken predecessor
Heyerdahl—they did get important things wrong—was this increasingly
accepted premise: early Asian and, perhaps, American peoples had been
crossing the Pacific for centuries, perhaps for millennia, before
Europeans appeared on the scene.


This paradigm shift can be traced, in part, to a series of recent
discoveries that demonstrate early mariners had both the capacity and
an interest in trade that regularly propelled them out of Asia and to
the New World.


When, for example, Victoria coastal archaeologist Daryl Fedje
announced a few years ago that he’d found datable 13,000-year-old
human artifacts on the Queen Charlotte Islands, his discovery was part
of a growing belief that prehistoric Asian nomads had the boats and
skills to navigate the B.C. coast.


Virtually gone today is the scientific concept of the Bering Strait
land bridge as the sole entry point for human migrations into Ice Age
North America. That theory is now an anachronism—as dead as the one
that once said God set the universe in motion on Wednesday, October
22, 4004 BC. Why cross several thousand kilometres of tundra and ice
when there’s plentiful fish, game, and dry land within reach of boats
on ice-free, Pacific coast promontories?


When archaeologists recently analyzed some buried ship’s planks on
California’s Channel Islands, they discovered that the sawn wood
likely had its origins in the Gilbert Islands, 7,500 kilometres to the
southwest, in the western central Pacific. And the wreck was 1,600
years old. When other researchers reported that New Mexico’s Zuni
Native blood types, religion, and language have unmistakable Japanese
links, or that old Mayan had common linguistic roots with old Sino-
Tibetan—and that these Asian influences appear to have arrived
abruptly within the past 1,500 years—it was a sign the iconoclasts of
Asian dispersal had overwhelmed the bastion of American uniqueness.


David Burley, chair of SFU’s department of archaeology, finds himself,
like most others in his field, having to assimilate this new, often
discomfiting information. It runs counter to a lot of preconceptions.


“The evidence clearly shows now,” he admits, “people moved from west
to east across the Pacific. If the Polynesians hit tiny Easter Island—
and they did—they had to hit South America. If they got to Hawaii—and
they did—they got to the Pacific Northwest. I have no doubt, in fact,
Hawaiians settled the Bella Coola Valley.”


There are Ainu ceremonial poles from northern Japan, he adds, that are
almost identical to West Coast poles. There’s old Polynesian bark
cloth that’s identical to Native cedar cloth here. And then there are
those strange Bella Coola petroglyphs.


Even more provocative, however, than the petroglyphs that inspired
Heyerdahl in 1939 is last year’s announcement by one of Burley’s own
doctoral students, Alice Storey, that DNA in 600-year-old chicken
bones found in Chile pinpoint the bird’s genetic origins in Samoa,
almost 8,000 kilometres across open ocean to the west.


It had been assumed by Eurocentric archaeologists that Atlantic-
crossing Spanish—not Pacific-crossing Polynesians—brought this Asian
bird to the New World. And to further the trans-Pacific argument, it’s
now also understood that these same maritime traders brought the
previously unknown sweet potato and the bottle gourd to Polynesia from
the Americas.


But when the issue of early Chinese travellers to British Columbia
comes up, Burley admits he has never heard of Fu Sang. This is
difficult to grasp, given the role that myths have often played in
major archeological breakthroughs. After all—and to mention just a few—
Hiram Bingham followed the trail of Quechuan rumours to Machu Picchu,
and Norwegian explorer Helge Ingstad and his archaeologist wife, Anne
Stine, followed the 1,000-year-old Norse sagas to L’Anse aux Meadows.


Could this lack of curiosity among many North American archaeologists
be testament to a lingering 20th-century bias that has downplayed
Asia’s influences on the West? Burley says of Fu Sang: “Anything’s
possible. Most myths have some kind of root basis in events.”


B.C. archaeologist George MacDonald, 70, director emeritus of the Bill
Reid Foundation, is one of those who didn’t succumb to the scientific
conceit of the Americas’ isolation from Asia. He has believed all
along that Asian traders and ideas have come to these shores since…
well, forever.


“It’s harder to explain why they did not come than why they did. The
first emperor,” he says, referring to a different Chinese myth dating
to 210 BC, “sent his fleet across the Pacific to find the ‘land of
immortality’. Those ships disappeared. Then came Fu Sang. There had to
be Chinese ships that came here!”


MacDonald has dug evidence of Bronze Age (3000 BC) Japanese-style
armour from a site near Prince Rupert. He has seen ancient, folded
birchbark boxes from Siberia that are mimicked by the traditional,
curve-sided cedar boxes of B.C. coastal Natives. He has seen how the
raven myth has survived among tribes on both sides of the Pacific.


He believes the circum-Pacific peoples have—despite the distances—
known about each other for millennia, traded and fought regularly, and
exchanged their ideas, their products, and their genes in a traffic
that helped shape the rise of the great cultures of the Americas. He
believes it’s time to follow the old myths.


“Most legends have some point of historical origin. But the old
stories get warped in time. The challenge in archaeology is to take
the warp out of it—to find the key sites and evidence and date them.
I’d say maybe one-tenth of one percent of B.C. archaeological sites
have been dug. Under the ocean…less. The day will come when we search
the ocean off B.C. If you were looking for Chinese remains, you’d get
results. Of course, it’s a needle-in-the-haystack situation. There’s a
lot of coastline, a lot of water. But if you’re not looking,” and he
points down, “you’re not going to find proof.”


The resolution to this mystery may well lie in one of several B.C.
places today. The first is the cabinet-filled archaeological-
collection room in Victoria’s Royal B.C. Museum. It is presided over
by its garrulous, 60-year-old curator, Grant Keddie, who acknowledges
that he has seen a dramatic shift in his field toward seeking
connections between Pacific cultures rather than trying to dismember
diffusion theorists and their theories.


And the more Keddie looks, the more he believes the proverbial
“needle” will soon be found. He pulls out a bunch of old perforated
Chinese coins dug in B.C. and dated by him to around AD 1100. But, he
says, there’s no proof these coins—like the old Chinese pots found off
Vancouver Island—arrived here new.


Traditionally, Native people wore old coins as good-luck charms.
Keddie points out that the 550-year-old “Ice Man” found frozen in a
B.C. glacier in 1999 was carrying iron tools at a time when iron
smelting was well known in East Asia but unknown in the Americas. So
where did the iron come from? He repeats B.C. Native myths of people
arriving long, long before the appearance of the first Europeans.


These strangers purportedly ate “maggots”. Could that have been rice?
He extracts from a drawer a six-centimetre-high figurine—with a
topknot, and of apparent Asian origin—found amid potsherds and slate
beads in a Native midden on Saturna Island. Could it be proof Asians
got here, or is it merely a trade artifact? He says he’d like to get a
piece of the wood that fisherman Mike Tyne tossed overboard the day
his crew found the Chinese pot off Pachena Bay. Carbon dating could
determine the age of the shipwreck. “Discussion is afoot,” Keddie
acknowledges. “The paradigm is changing. Scientists are now looking
for the evidence to establish China’s role in history.”


A second place to look would be the old office of the former director
of the Vancouver Maritime Museum, James Delgado. As an archaeologist
and host of the long-running TV series Sea Hunter, he knows that myths
and isolated artifacts cannot alone make the case for Chinese mariners
coming to the B.C. coast long ago. For that, you need a shipwreck, he
said in an interview before he left the museum to take a job in the
U.S.


“If you take the accounts of the Chinese at face value, they did get
here. The Fu Sang story says so. But there’s been a tendency in the
West to dismiss the influence of the East. We’ve pretty much discarded
that view now. And that,” he said, pointing dramatically across his
desk and downward toward the floor, “that fits our postmodern view.
We’re rejecting Eurocentric world history and the idea of American
uniqueness and beginning to accept historic Asian ties to the
Americas.”


His fingertip aimed at one of the two intact Chinese pots pulled from
1,200 metres of water off Tofino, the location of the latest purported
Asian shipwreck. The half-metre-high pot was covered with swirling,
white tunicate worm casts atop its beer-brown glaze. Delgado studied
the almost calligraphic casts as if trying to read an illegible
script. “If we discover an Asian shipwreck off this coast,” he added,
“it would be one of the most significant discoveries in North American
archaeology.”


A third place to look is the living room of Michelle Morelan’s
suburban Steveston home. She’s the daughter of Mike Tyne. On the floor
in the corner, covered in white worm casts, is the very Chinese pot
her father hauled up off Pachena Bay years ago. Curiously, balanced
atop the upright pot’s mouth is a large green glass Japanese fishnet
float, identical to those that once inspired Heyerdahl. To hold this
giant Chinese pot, to run one’s fingers over the rough, raised worm
casts, is to sense the proximity of mystery. “If only the pot could
talk,” Morelan says.


More than a century ago, B.C. ethnologists recorded a story from the
Loht’a people of Pachena Bay, describing a great flood that had swept
away their village long before and had submerged the summit of nearby
1,817-metre Mt. Arrowsmith.


For 100 years, this tale was considered nothing more than a myth. Then
a decade ago, a Japanese seismologist, analyzing records of local
tsunamis, uncovered reports of a great wave that had inundated the
Japanese coast on January 27, 1700. But he could find no accounts—
despite a Russian presence in Alaska and a Spanish presence along most
of the west coast of the Americas—of a big earthquake.


The only gap in reliable reporting at that time was the still-
unconquered Pacific coast of Canada. Archaeologists began digging
along coastal B.C. and soon found that a 10-metre tsunami had swept
into Pachena Bay that day and had obliterated the village there. The
old Loht’a myth had its roots, it is now known, in British Columbia’s
last great earthquake.


It is widely believed today—after a century of denial—that evidence of
ancient Asian travellers along this coast is out there somewhere, and
that the remarkable Chinese myth of Fu Sang and the gathering weight
of local artifacts and Native stories are pointing the way to a new
understanding of the past. It shouldn’t come as a surprise—considering
the likely direction of 21st-century history—that the metaphorical
tsunami headed across the Pacific from an ascendant China in the
decades ahead may duplicate, in many ways, the cultural tsunami that
swept the Pacific coast of the Americas millennia ago. Myths are
history’s pale ink. One Chinese shipwreck found, and history changes.

Source Article

Wednesday, July 2, 2008

Balkan caves, gorges were pre-Neanderthal haven

Balkan caves, gorges were pre-Neanderthal haven
Fri Jun 27, 2008 11:25am EDT

By Ljilja Cvekic


BELGRADE (Reuters Life!) - A fragment of a human jaw found in Serbia
and believed to be up to 250,000 years old is helping anthropologists
piece together the story of prehistoric human migration from Africa to
Europe.


"This is the earliest evidence we have of humans in the area,"
Canada's Winnipeg University anthropology professor Mirjana Roksandic
told Reuters.


The fragment of a lower jaw, complete with three teeth, was discovered
in a small cave in the Sicevo gorge in south Serbia.


"It is a pre-Neanderthal jaw that we believe is between 130,000 to
250,000 years old," said Belgrade University archaeology professor
Dusan Mihailovic, head of the team studying the jaw.


"It could help us explain better the human evolution and implications
of movements of the population and culture across a large territory,"
he said.


Anthropologists believe Africa was the birthplace of man, who then
migrated northwards into the Middle East and Europe, possibly in
reaction to climate changes.


During the periodic ice ages northern Europe would have been covered
in ice, so the theory is these early humans stayed in the easier
climate of southern Europe.


The jaw might belong to homo erectus, the first type of human to walk
upright, who appeared in Africa 1.8 million years ago and was the
precursor of both modern man, or homo sapiens, and the separate
species of Neanderthal man.


The jaw was found at a depth of four meters, below a Neanderthal
village in a linked cave, one of the richest archaeological sites in
the region.


The remains of a hearth, primitive stone and bone tools and animals
indicated an 80,000 year old home base.


"What we found there was enough to reconstruct the way of living,
changes in culture, climate, vegetation and animal life during a
longer period of some 50,000 years," Mihailovic said.


"The fact we found a jaw so many layers below the settlement is
additional proof the jaw is much older."


Archaeologists started digging deeper initially in the hope of finding
more fossil remains.


"We were looking for Neanderthals," Roksandic said, "but this is much
better."


Neanderthals, viewed as a evolutionary dead-end, died out about 30,000
years ago.

Insights into original explorers

If anyone believes that every canoe made the voyages safely I have
some reference material describing the sending out of several canoes
and only one returning. The idea of sailing against the wind is an age-
old one, sometimes hard to prove 3000 years later.

Picture at the cite.


Insights into original explorers
5:00AM Saturday June 28, 2008
By Craig Borley
Professors Richard Flay (left) and Geoffrey Irwin look on as wind
tunnel manager David le Pelley makes adjustments to the model of an
ancestral canoe. Photo / Brett Phibbs


A replica 3000-year-old Pacific canoe, modelled on the world's first
ocean-going vessels, has been tested in a world-leading Auckland wind
tunnel.


Preliminary results show the canoes of the type sailed from New Guinea
to Fiji, Tonga and Samoa about 1000BC were so well designed they could
probably sail against the wind.


The 3m-long scale model has been tested and analysed in the University
of Auckland's Tamaki campus wind tunnel, famed for its role in
America's Cup yacht design.


The project, a joint venture between the university's engineering and
archaeology departments, was set up to end a long-running debate:
whether the first ocean explorers depended on luck or design to get to
their destinations.


The team used archaeological and linguistic evidence to design the
canoe, a design they believe is most likely to have made the world's
first major ocean-going voyages.


The original canoes' construction would have required immense amounts
of labour, depended on specialised stone adzes, and used kilometres of
cord, mechanical engineering professor Richard Flay said.


Its sailors set out against prevailing southeast trade winds, with
probably 12 or more passengers, livestock, and potted plants.


Leaving such a trip to the chance of winds, tides and the hope of an
El Nino weather pattern is one of the two major theories, Professor
Flay said.


The second theory surmised the sailors and boatbuilders were highly
skilled, and sailed where they wanted to go with extensive control of
their vessels.


The evidence being gleaned from the wind tunnel tests supported that
theory, showing the vessels could be steered by skilled mariners,
archaeology professor Geoff Irwin said.


The population base of the Lapita people who made the epic voyages was
low, yet they colonised a vast ocean very quickly, adding weight to
the argument their sailing and boat-building skills were significantly
further advanced than any one else at the time.


"If it's kamikaze canoes, the losses have got to be huge, because it's
an empty ocean. But the attrition can't have been much. I think their
losses have been fairly slim. They must have been able to sail."


The Pacific sailors reached America about 1000 years ago, all but
completing their exploration of the world's biggest ocean.


At the same time, Viking sailors were reaching the northeast coast of
America, still at the beginning of their ocean-roaming exploits.


The scale model being tested was based on a 14m long, 1.2m diameter
dug-out log, lined on its upper sides with planks to stop water
splashing in.


It was supported by outriggers on either side, making it virtually
impossible to roll. Its two-spar rigging system allowed the wind's
power to go through one spar to the hull, while the second spar could
be used to trim the sail and adjust to conditions.


"They could alter the sails depending on the heading they wanted to go
in, to get the fastest speed," Professor Irwin said


http://www.nzherald.co.nz/section/1/story.cfm?c_id=1&objectid=10518760

Maize (Corn) May Have Been Domesticated In Mexico As Early As 10,000

http://www.sciencedaily.com/releases/2008/06/
080627163156.htm
Maize (Corn) May Have Been Domesticated In Mexico As Early As 10,000
Years Ago


ScienceDaily (June 27, 2008) — The ancestors of maize originally grew
wild in Mexico and were radically different from the plant that is now
one of the most important crops in the world. While the evidence is
clear that maize was first domesticated in Mexico, the time and
location of the earliest domestication and dispersal events are still
in dispute.


Now, in addition to more traditional macrobotanical and archeological
remains, scientists are using new genetic and microbotanical
techniques to distinguish domesticated maize from its wild relatives
as well as to identify ancient sites of maize agriculture. These new
analyses suggest that maize may have been domesticated in Mexico as
early as 10,000 years ago.


Dr. John Jones and his colleagues, Mary Pohl, and Kevin Pope, have
evaluated multiple lines of evidence, including paleobotanical remains
such as pollen, phytoliths, and starch grains, as well as genetic
analyses, to reconstruct the early history of maize agriculture. Dr.
Jones, of the Department of Anthropology, Washington State University,
Pullman, will be presenting this work at a symposium on Maize Biology
at the annual meeting of the American Society of Plant Biologists in
Mérida, Mexico (June 28, 2008).


While macrobotanical remains such as maize kernels, cobs, and leaves
have been found in dry mountain caves, such remains are not preserved
in more humid lowland areas, so the conclusions based on such remains
are fragmentary. Much smaller parts of the maize plant, like cellular
silica deposits, called phytoliths, and pollen and starch grains, are
preserved under both humid and dry conditions. These lines of
evidence, along with genetic and archeological data, are being used to
reconstruct the history of agriculture to its origins around the
world.


Maize is wind pollinated and sheds large amounts of pollen, which is
deposited in soil and water sediments. The tough outer wall (exine) of
pollen protects it from deterioration for thousands of years. While it
is possible to distinguish the pollen grains of maize and its close
relatives from other grasses, it is more difficult, except at the
largest sizes, to differentiate the pollen of maize (Zea mays) from
its presumed wild ancestor teosinte (Zea sp). Thus, while pollen can
provide evidence of the presence of domesticated maize, along with
that from other plants indicating agricultural activity, maize pollen
alone is not definitive evidence of domesticated plants.


Phytoliths are another type of plant microfossil that is preserved for
thousands of years and can be used to distinguish domesticated from
wild maize. These microscopic bodies are silica or calcium oxalate
deposits that accumulate in the intercellular spaces of plant stems,
leaves, and roots and have characteristic shapes depending on genus
and species. They are preserved even when the plant is burned or
disintegrated. Scientists have found that it is possible to
distinguish the microliths of teosinte from those of maize and other
grasses, thus allowing them to identify the approximate dates and
locations of early agricultural activity. Phytoliths are also
preserved on ceramic and stone artifacts used to process food.


Jones and his co-workers analyzed the sediments from San Andrés, in
the state of Tabasco on the Mexican Gulf Coast. Analysis of area
sediments revealed phytoliths of domesticated varieties of maize as
well as those of agricultural weeds. These data, along with evidence
of burning, suggested that agriculturalists were active in that part
of the Yucatan Peninsula around 7,000 years ago.


Starch grains are the most recent addition to the archeobotanical
toolbox. Maize and its grass relatives produce large quantities of
starch grains with unique morphological characteristics and, like
phytoliths, are preserved in sediments and on cultural artifacts.
Maize produces more starch than its wild relative teosinte, and the
grains are much larger. The paleobotanist Dolores Piperno and her
colleagues have established a number of criteria for distinguishing
the starch grains of different grasses and found that those of maize
and teosinte could be reliably separated on the basis of size and
other morphological characters.


Maize also has a rich genetic history, which has resulted in thousands
of varieties or landraces adapted to different environmental
conditions. Maize scientists and geneticists have used this
information to track the evolution and dispersal of maize varieties as
well as to reconstruct the history of maize domestication. For
example, the locus teosinte glume architecture 1 (tga1), is important
in determining phytolith formation and morphology and, along with
other "domestication genes" can be used to write the history of maize
domestication and use by humans.


All of these methods are being used by paleobotanists, plant
scientists, and archeologists like Jones and his colleagues, to
reconstruct the rich history of maize domestication and evolution.
Many of the ancient varieties were adaptations to different
environmental conditions such as different soils, temperature,
altitude, and drought. Preservation of these varieties and knowledge
of their genetic and adaptive histories are of paramount importance as
farmers around the world cope with changes in soil, temperature, and
water availability and struggle to maintain a food supply for growing
populations.


the press release

Newcomer in Early Eurafrican Population?

Newcomer in Early Eurafrican Population?


Posted on behalf of:
CNRS (Délégation Paris Michel-Ange)
30 June 2008
"*"
A complete mandible of Homo erectus was discovered at the Thomas I
quarry in Casablanca by a French-Moroccan team co-led by Jean-Paul
Raynal, CNRS senior researcher at the PACEA[1] laboratory (CNRS/
Université Bordeaux 1/ Ministry of Culture and Communication). This
mandible is the oldest human fossil uncovered from scientific
excavations in Morocco. The discovery will help better define northern
Africa's possible role in first populating southern Europe.


A Homo erectus half-jaw had already been found at the Thomas I quarry
in 1969, but it was a chance discovery and therefore with no
archeological context. This is not the case for the fossil discovered
May 15, 2008, whose characteristics are very similar to those of the
half-jaw found in 1969. The morphology of these remains is different
from the three mandibles found at the Tighenif site in Algeria that
were used, in 1963, to define the North African variety of Homo
erectus, known as Homo mauritanicus, dated to 700,000 B.C.


The mandible from the Thomas I quarry was found in a layer below one
where the team has previously found four human teeth (three premolars
and one incisor) from Homo erectus, one of which was dated to 500,000
B.C. The human remains were grouped with carved stone tools
characteristic of the Acheulian[2] civilization and numerous animal
remains (baboons, gazelles, equines, bears, rhinoceroses, and
elephants), as well as large numbers of small mammals, which point to
a slightly older time frame. Several dating methods are being used to
refine the chronology.


The Thomas I quarry in Casablanca confirms its role as one of the most
important prehistoric sites for understanding the early population of
northwest Africa. The excavations that CNRS and the Institut National
des Sciences de l'Archéologie et du Patrimoine du Maroc have led there
since 1988 are part of a French-Moroccan collaboration. They have been
jointly financed by the French Ministry of Foreign Affairs[3], the
Department of Human Evolution at the Max Plank Institute in Leipzig
(Germany), INSAP[4] (Morocco) and the Aquitaine region.


[1] De la Préhistoire à l'Actuel : Culture, Environnement et
Anthropologie (From Prehistory to Present day: Culture, Environment,
and Anthropology)
[2] Acheulians appeared in Africa around 1.5 million years ago and
disappeared about 300,000 years ago, giving way to Middle Stone Age
civilizations. Their material culture is characterized by the
production of large stone fragments shaped into bifacial pieces and
hatchets, and of large sharp-edged objects.
[3] (Mission archéologique « littoral » Maroc, led by J.P. Raynal).[4]
(INSAP-Rabat) which falls under the authority of the Moroccan Ministry
of Cultural Affairs.


Contact INFORMATION


Researcher
Jean-Paul Raynal
05 40 00 88 89
jpray...@wanadoo.fr


Public Information Officer
Laetitia Louis
01 44 96 51 37
Laetitia.lo...@cnrs-dir.fr